KRSFIEDLLFNKV-The Covid19 Virus general sequence used to make a vaccine…maybe.


abstract technology science concept DNA binary on hi tech blue background

The letters in the title are the single letters that represent the dominant amino acids in the SARS- CV2 virus.We know from Dr. Chavez that the CV2 signature is artificial but the NIH scientists are looking at the natural zoonotic one. I don’t think they are the same. NIH may be lying.

This might be false information again to throw everyone off the track. Remember, they’ve been working on the artificial signature since 2009 and the real questions will be, once the artificial signature is analyzed in light of the Tzolkin how will the vaccine mRNA sequence they have manufactured interact with it?

Since it’s mRNA it can keep mutating. They address that in the link above but not to my satisfaction. This is messenger RNA which is part of the initiation of the RNA sequence.

Q: What determines the mRNA codon?

A: The cellular discussion between the ribosome and the amino acid through the tRNA or transfer RNA which is the Tzolkin Themeplex. They have no clue. My book isn’t out yet.

The tRNA looks like the Tzolkin themeplex and I go into it extensively in my book.

This is 4Leucine∞4Asparigine, 4Valine, 4Tyrosine, 10Glutamine as a tRNA molecule in my opinion. The 3 dimensional image above of the double helix corresponds exactly to the binary triplet configuration I have figured out and have made a huge complex document I’m currently getting into my book that will explain how the G.A.P. kin of the Tzolkin form the ladders that likely are the ribosomes and the double helix may be the sugar backbone. I’m not sure yet. But it all pulses exactly off of the mother’s DNA in the double helix as the Hidden Wisdom or subconscious mind everyday.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151553/

It boils down to this. Note that there are 13 Amino Acids in the Sequence the NIH gives us. If only the scientists understood the application of the 13 Tones of Creation it would revolutionize genetics.

I’m breaking down the sequence from the TITLE above

  • White Wizard is K or Lysine – 1st appearance
  • Blue Eagle is R or Arginine
  • Red Serpent is S or Serine
  • Red Earth is F or Phenylalanine
  • Blue Hand is I or Isoleucine These two
  • Yellow Human is E or Glutamic Acid are analog
  • White Dog is D or Aspartic Acid
  • Yellow Star is L or Leucine
  • Yellow Star is L or Leucine
  • Red Earth is F or Phenylalanine
  • Blue Monkey is N or Asparagine
  • White Wizard is L or Lysine—Last appearance
  • Yellow Seed is V or Valine

It turns out this sequence is found in all zoonotic origin coronaviruses and it is very bare bones, no start or stop codons nor the rest of the 20 amino acids.

Zoonotic means we evolved from animals and ARE animals. This is no big news. The big news that they are not specking out is the artificial sequence which I already have. What is the agenda behind the creation of the artificial signature?

Note that the sequence begins with the White Wizard and Ends at #12 with the White Wizard and then is SEEDED into the ground via Valine or the Yellow Seed Tribe.

I may add more to this or I may not. The link above is very long and involved but I’m not sure I trust it.

Lisa T.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


This post is from August 2020.

Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made


Today is June 5, 2024, and I’m posting it again. When are people going to listen? They made a toxic vaccine. I warned people.

I posted this July 23, 2020, a year and a half ago.

For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

91 Research Studies Affirm Naturally Acquired Immunity to Covid-19: Documented, Linked, and Quoted


Our evolving human RNA responding to any virus is more than adequate to protect us through an illness if we take care of ourselves in basic ways.

Lisa T.

BY PAUL ELIAS ALEXANDER   OCTOBER 17, 2021   PUBLIC HEALTH   40 MINUTE READSHARE | PRINT | EMAILFacebookTwitterRedditLinkedInFlipboardTelegramPrintEmailShare

We should not force COVID vaccines on anyone when the evidence shows that naturally acquired immunity is equal to or more robust and superior to existing vaccines. Instead, we should respect the right of the bodily integrity of individuals to decide for themselves. 

Public health officials and the medical establishment with the help of the politicized media are misleading the public with assertions that the COVID-19 shots provide greater protection than natural immunity.  CDC Director Rochelle Walensky, for example, was deceptive in her October 2020 published LANCET statement that “there is no evidence for lasting protective immunity to SARS-CoV-2 following natural infection” and that “the consequence of waning immunity would present a risk to vulnerable populations for the indefinite future.” 

Immunology and virology 101 have taught us over a century that natural immunity confers protection against a respiratory virus’s outer coat proteins, and not just one, e.g. the SARS-CoV-2 spike glycoprotein. There is even strong evidence for the persistence of antibodies. Even the CDC recognizes natural immunity for chicken-pox and measles, mumps, and rubella, but not for COVID-19. 

The vaccinated are showing viral loads (very high) similar to the unvaccinated (Acharya et al. and Riemersma et al.), and the vaccinated are as infectious. Riemersma et al. also report Wisconsin data that corroborate how the vaccinated individuals who get infected with the Delta variant can potentially (and are) transmit(ting) SARS-CoV-2 to others (potentially to the vaccinated and unvaccinated). 

This troubling situation of the vaccinated being infectious and transmitting the virus emerged in seminal nosocomial outbreak papers by Chau et al. (HCWs in Vietnam), the Finland hospital outbreak (spread among HCWs and patients), and the Israel hospital outbreak (spread among HCWs and patients). These studies also revealed that the PPE and masks were essentially ineffective in the healthcare setting.⁹ Again, the Marek’s disease in chickens and the vaccination situation explains what we are potentially facing with these leaky vaccines (increased transmission, faster transmission, and more ‘hotter’ variants). 

Moreover, existing immunity should be assessed before any vaccination, via an accurate, dependable, and reliable antibody test (or T cell immunity test) or be based on documentation of prior infection (a previous positive PCR or antigen test). Such would be evidence of immunity that is equal to that of vaccination and the immunity should be provided the same societal status as any vaccine-induced immunity. This will function to mitigate the societal anxiety with these forced vaccine mandates and societal upheaval due to job loss, denial of societal privileges etc. Tearing apart the vaccinated and the unvaccinated in a society, separating them, is not medically or scientifically supportable. 

The Brownstone Institute previously documented 30 studies on natural immunity as it relates to Covid-19. 

This follow-up chart is the most updated and comprehensive library list of 91 of the highest-quality, complete, most robust scientific studies and evidence reports/position statements on natural immunity as compared to the COVID-19 vaccine-induced immunity and allow you to draw your own conclusion.

I’ve benefited from the input of many to put this together, especially my co-authors:

  • Dr. Harvey Risch, MD, PhD (Yale School of Public Health) 
  • Dr. Howard Tenenbaum, PhD ( Faculty of Medicine, University of Toronto)
  • Dr. Ramin Oskoui, MD (Foxhall Cardiology, Washington)
  • Dr. Peter McCullough, MD (Truth for Health Foundation (TFH)), Texas
  • Dr. Parvez Dara, MD (consultant, Medical Hematologist and Oncologist)


Evidence on natural immunity versus COVID-19 vaccine induced immunity as of October 15th 2021:

Study / report title, author, and year publishedPredominant finding on natural immunity1) Necessity of COVID-19 vaccination in previously infected individuals, Shrestha, 2021“Cumulative incidence of COVID-19 was examined among 52,238 employees in an American healthcare system.

The cumulative incidence of SARS-CoV-2 infection remained almost zero among previously infected unvaccinated subjects, previously infected subjects who were vaccinated, and previously uninfected subjects who were vaccinated, compared with a steady increase in cumulative incidence among previously uninfected subjects who remained unvaccinated. Not one of the 1359 previously infected subjects who remained unvaccinated had a SARS-CoV-2 infection over the duration of the study. 

Individuals who have had SARS-CoV-2 infection are unlikely to benefit from COVID-19 vaccination…”2) SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls, Le Bert, 2020“Studied T cell responses against the structural (nucleocapsid (N) protein) and non-structural (NSP7 and NSP13 of ORF1) regions of SARS-CoV-2 in individuals convalescing from coronavirus disease 2019 (COVID-19) (n = 36). In all of these individuals, we found CD4 and CD8 T cells that recognized multiple regions of the N protein…showed that patients (n = 23) who recovered from SARS possess long-lasting memory T cells that are reactive to the N protein of SARS-CoV 17 years after the outbreak of SARS in 2003; these T cells displayed robust cross-reactivity to the N protein of SARS-CoV-2.”3) Comparing SARS-CoV-2 natural immunity to vaccine-induced immunity: reinfections versus breakthrough infections,Gazit, 2021“A retrospective observational study comparing three groups: (1) SARS-CoV-2-naïve individuals who received a two-dose regimen of the BioNTech/Pfizer mRNA BNT162b2 vaccine, (2) previously infected individuals who have not been vaccinated, and (3) previously infected and single dose vaccinated individuals found para a 13 fold increased risk of breakthrough Delta infections in double vaccinated persons, and a 27 fold increased risk for symptomatic breakthrough infection in the double vaccinated relative to the natural immunity recovered persons…the risk of hospitalization was 8 times higher in the double vaccinated (para)…this analysis demonstrated that natural immunity affords longer lasting and stronger protection against infection, symptomatic disease and hospitalization due to the Delta variant of SARS-CoV-2, compared to the BNT162b2 two-dose vaccine-induced immunity.”4) Highly functional virus-specific cellular immune response in asymptomatic SARS-CoV-2 infection, Le Bert, 2021“Studied SARS-CoV-2–specific T cells in a cohort of asymptomatic (n = 85) and symptomatic (n = 75) COVID-19 patients after seroconversion…thus, asymptomatic SARS-CoV-2–infected individuals are not characterized by weak antiviral immunity; on the contrary, they mount a highly functional virus-specific cellular immune response.”5) Large-scale study of antibody titer decay following BNT162b2 mRNA vaccine or SARS-CoV-2 infection, Israel, 2021“A total of 2,653 individuals fully vaccinated by two doses of vaccine during the study period and 4,361 convalescent patients were included. Higher SARS-CoV-2 IgG antibody titers were observed in vaccinated individuals (median 1581 AU/mL IQR [533.8-5644.6]) after the second vaccination, than in convalescent individuals (median 355.3 AU/mL IQR [141.2-998.7]; p<0.001). In vaccinated subjects, antibody titers decreased by up to 40% each subsequent month while in convalescents they decreased by less than 5% per month…this study demonstrates individuals who received the Pfizer-BioNTech mRNA vaccine have different kinetics of antibody levels compared to patients who had been infected with the SARS-CoV-2 virus, with higher initial levels but a much faster exponential decrease in the first group”.6) SARS-CoV-2 re-infection risk in Austria, Pilz, 2021Researchers recorded “40 tentative re-infections in 14, 840 COVID-19 survivors of the first wave (0.27%) and 253 581 infections in 8, 885, 640 individuals of the remaining general population (2.85%) translating into an odds ratio (95% confidence interval) of 0.09 (0.07 to 0.13)…relatively low re-infection rate of SARS-CoV-2 in Austria. Protection against SARS-CoV-2 after natural infection is comparable with the highest available estimates on vaccine efficacies.” Additionally, hospitalization in only five out of 14,840 (0.03%) people and death in one out of 14,840 (0.01%) (tentative re-infection).7) mRNA vaccine-induced SARS-CoV-2-specific T cells recognize B.1.1.7 and B.1.351 variants but differ in longevity and homing properties depending on prior infection status, Neidleman, 2021“Spike-specific T cells from convalescent vaccinees differed strikingly from those of infection-naïve vaccinees, with phenotypic features suggesting superior long-term persistence and ability to home to the respiratory tract including the nasopharynx. These results provide reassurance that vaccine-elicited T cells respond robustly to the B.1.1.7 and B.1.351 variants, confirm that convalescents may not need a second vaccine dose.”8) Good news: Mild COVID-19 induces lasting antibody protection, Bhandari, 2021“Months after recovering from mild cases of COVID-19, people still have immune cells in their body pumping out antibodies against the virus that causes COVID-19, according to a study from researchers at Washington University School of Medicine in St. Louis. Such cells could persist for a lifetime, churning out antibodies all the while. The findings, published May 24 in the journal Nature, suggest that mild cases of COVID-19 leave those infected with lasting antibody protection and that repeated bouts of illness are likely to be uncommon.”9) Robust neutralizing antibodies to SARS-CoV-2 infection persist for months, Wajnberg, 2021“Neutralizing antibody titers against the SARS-CoV-2 spike protein persisted for at least 5 months after infection. Although continued monitoring of this cohort will be needed to confirm the longevity and potency of this response, these preliminary results suggest that the chance of reinfection may be lower than is currently feared.”10) Evolution of Antibody Immunity to SARS-CoV-2, Gaebler, 2020“Concurrently, neutralizing activity in plasma decreases by five-fold in pseudo-type virus assays. In contrast, the number of RBD-specific memory B cells is unchanged. Memory B cells display clonal turnover after 6.2 months, and the antibodies they express have greater somatic hypermutation, increased potency and resistance to RBD mutations, indicative of continued evolution of the humoral response…we conclude that the memory B cell response to SARS-CoV-2 evolves between 1.3 and 6.2 months after infection in a manner that is consistent with antigen persistence.”11) Persistence of neutralizing antibodies a year after SARS-CoV-2 infection in humans, Haveri, 2021“Assessed the persistence of serum antibodies following WT SARS-CoV-2 infection at 8 and 13 months after diagnosis in 367 individuals…found that NAb against the WT virus persisted in 89% and S-IgG in 97% of subjects for at least 13 months after infection.”12) Quantifying the risk of SARS‐CoV‐2 reinfection over time, Murchu, 2021“Eleven large cohort studies were identified that estimated the risk of SARS‐CoV‐2 reinfection over time, including three that enrolled healthcare workers and two that enrolled residents and staff of elderly care homes. Across studies, the total number of PCR‐positive or antibody‐positive participants at baseline was 615,777, and the maximum duration of follow‐up was more than 10 months in three studies. Reinfection was an uncommon event (absolute rate 0%–1.1%), with no study reporting an increase in the risk of reinfection over time.”13) Natural immunity to covid is powerful. Policymakers seem afraid to say so, Makary, 2021Makary writes “it’s okay to have an incorrect scientific hypothesis. But when new data proves it wrong, you have to adapt. Unfortunately, many elected leaders and public health officials have held on far too long to the hypothesis that natural immunity offers unreliable protection against covid-19 — a contention that is being rapidly debunked by science. More than 15 studies have demonstrated the power of immunity acquired by previously having the virus. A 700,000-person study from Israel two weeks ago found that those who had experienced prior infections were 27 times less likely to get a second symptomatic covid infection than those who were vaccinated. This affirmed a June Cleveland Clinic study of health-care workers (who are often exposed to the virus), in which none who had previously tested positive for the coronavirus got reinfected. The study authors concluded that “individuals who have had SARS-CoV-2 infection are unlikely to benefit from covid-19 vaccination.” And in May, a Washington University study found that even a mild covid infection resulted in long-lasting immunity.”14) SARS-CoV-2 elicits robust adaptive immune responses regardless of disease severity, Nielsen, 2021“203 recovered SARS-CoV-2 infected patients in Denmark between April 3rd and July 9th 2020, at least 14 days after COVID-19 symptom recovery… report broad serological profiles within the cohort, detecting antibody binding to other human coronaviruses… the viral surface spike protein was identified as the dominant target for both neutralizing antibodies and CD8+ T-cell responses. Overall, the majority of patients had robust adaptive immune responses, regardless of their disease severity.”15) Protection of previous SARS-CoV-2 infection is similar to that of BNT162b2 vaccine protection: A three-month nationwide experience from Israel, Goldberg, 2021“Analyze an updated individual-level database of the entire population of Israel to assess the protection efficacy of both prior infection and vaccination in preventing subsequent SARS-CoV-2 infection, hospitalization with COVID-19, severe disease, and death due to COVID-19… vaccination was highly effective with overall estimated efficacy for documented infection of 92·8% (CI:[92·6, 93·0]); hospitalization 94·2% (CI:[93·6, 94·7]); severe illness 94·4% (CI:[93·6, 95·0]); and death 93·7% (CI:[92·5, 94·7]). Similarly, the overall estimated level of protection from prior SARS-CoV-2 infection for documented infection is 94·8% (CI: [94·4, 95·1]); hospitalization 94·1% (CI: [91·9, 95·7]); and severe illness 96·4% (CI: [92·5, 98·3])…results question the need to vaccinate previously-infected individuals.”16) Incidence of Severe Acute Respiratory Syndrome Coronavirus-2 infection among previously infected or vaccinated employees, Kojima, 2021“Employees were divided into three groups: (1) SARS-CoV-2 naïve and unvaccinated, (2) previous SARS-CoV-2 infection, and (3) vaccinated. Person-days were measured from the date of the employee first test and truncated at the end of the observation period. SARS-CoV-2 infection was defined as two positive SARS-CoV-2 PCR tests in a 30-day period… 4313, 254 and 739 employee records for groups 1, 2, and 3…previous SARS-CoV-2 infection and vaccination for SARS-CoV-2 were associated with decreased risk for infection or re-infection with SARS-CoV-2 in a routinely screened workforce. The was no difference in the infection incidence between vaccinated individuals and individuals with previous infection.” 17) Having SARS-CoV-2 once confers much greater immunity than a vaccine—but vaccination remains vital, Wadman, 2021“Israelis who had an infection were more protected against the Delta coronavirus variant than those who had an already highly effective COVID-19 vaccine…the newly released data show people who once had a SARS-CoV-2 infection were much less likely than never-infected, vaccinated people to get Delta, develop symptoms from it, or become hospitalized with serious COVID-19.”18) One-year sustained cellular and humoral immunities of COVID-19 convalescents, Zhang, 2021“A systematic antigen-specific immune evaluation in 101 COVID-19 convalescents; SARS-CoV-2-specific IgG antibodies, and also NAb can persist among over 95% COVID-19 convalescents from 6 months to 12 months after disease onset. At least 19/71 (26%) of COVID-19 convalescents (double positive in ELISA and MCLIA) had detectable circulating IgM antibody against SARS-CoV-2 at 12m post-disease onset. Notably, the percentages of convalescents with positive SARS-CoV-2-specific T-cell responses (at least one of the SARS-CoV-2 antigen S1, S2, M and N protein) were 71/76 (93%) and 67/73 (92%) at 6m and 12m, respectively.” 19) Functional SARS-CoV-2-Specific Immune Memory Persists after Mild COVID-19, Rodda, 2021“Recovered individuals developed SARS-CoV-2-specific immunoglobulin (IgG) antibodies, neutralizing plasma, and memory B and memory T cells that persisted for at least 3 months. Our data further reveal that SARS-CoV-2-specific IgG memory B cells increased over time. Additionally, SARS-CoV-2-specific memory lymphocytes exhibited characteristics associated with potent antiviral function: memory T cells secreted cytokines and expanded upon antigen re-encounter, whereas memory B cells expressed receptors capable of neutralizing virus when expressed as monoclonal antibodies. Therefore, mild COVID-19 elicits memory lymphocytes that persist and display functional hallmarks of antiviral immunity.”20) Discrete Immune Response Signature to SARS-CoV-2 mRNA Vaccination Versus Infection, Ivanova, 2021“Performed multimodal single-cell sequencing on peripheral blood of patients with acute COVID-19 and healthy volunteers before and after receiving the SARS-CoV-2 BNT162b2 mRNA vaccine to compare the immune responses elicited by the virus and by this vaccine…both infection and vaccination induced robust innate and adaptive immune responses, our analysis revealed significant qualitative differences between the two types of immune challenges. In COVID-19 patients, immune responses were characterized by a highly augmented interferon response which was largely absent in vaccine recipients. Increased interferon signaling likely contributed to the observed dramatic upregulation of cytotoxic genes in the peripheral T cells and innate-like lymphocytes in patients but not in immunized subjects. Analysis of B and T cell receptor repertoires revealed that while the majority of clonal B and T cells in COVID-19 patients were effector cells, in vaccine recipients clonally expanded cells were primarily circulating memory cells…we observed the presence of cytotoxic CD4 T cells in COVID-19 patients that were largely absent in healthy volunteers following immunization. While hyper-activation of inflammatory responses and cytotoxic cells may contribute to immunopathology in severe illness, in mild and moderate disease, these features are indicative of protective immune responses and resolution of infection.”21) SARS-CoV-2 infection induces long-lived bone marrow plasma cells in humans, Turner, 2021“Bone marrow plasma cells (BMPCs) are a persistent and essential source of protective antibodies… durable serum antibody titres are maintained by long-lived plasma cells—non-replicating, antigen-specific plasma cells that are detected in the bone marrow long after the clearance of the antigen … S-binding BMPCs are quiescent, which suggests that they are part of a stable compartment. Consistently, circulating resting memory B cells directed against SARS-CoV-2 S were detected in the convalescent individuals. Overall, our results indicate that mild infection with SARS-CoV-2 induces robust antigen-specific, long-lived humoral immune memory in humans…overall, our data provide strong evidence that SARS-CoV-2 infection in humans robustly establishes the two arms of humoral immune memory: long-lived bone marrow plasma cells (BMPCs) and memory B-cells.”22) SARS-CoV-2 infection rates of antibody-positive compared with antibody-negative health-care workers in England: a large, multicentre, prospective cohort study (SIREN), Jane Hall, 2021“The SARS-CoV-2 Immunity and Reinfection Evaluation study… 30 625 participants were enrolled into the study… a previous history of SARS-CoV-2 infection was associated with an 84% lower risk of infection, with median protective effect observed 7 months following primary infection. This time period is the minimum probable effect because seroconversions were not included. This study shows that previous infection with SARS-CoV-2 induces effective immunity to future infections in most individuals.”23) Pandemic peak SARS-CoV-2 infection and seroconversion rates in London frontline health-care workers, Houlihan, 2020“Enrolled 200 patient-facing HCWs between March 26 and April 8, 2020…represents a 13% infection rate (i.e. 14 of 112 HCWs) within the 1 month of follow-up in those with no evidence of antibodies or viral shedding at enrolment. By contrast, of 33 HCWs who tested positive by serology but tested negative by RT-PCR at enrolment, 32 remained negative by RT-PCR through follow-up, and one tested positive by RT-PCR on days 8 and 13 after enrolment.”24) Antibodies to SARS-CoV-2 are associated with protection against reinfection, Lumley, 2021“Critical to understand whether infection with Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) protects from subsequent reinfection… 12219 HCWs participated…prior SARS-CoV-2 infection that generated antibody responses offered protection from reinfection for most people in the six months following infection.”25) Longitudinal analysis shows durable and broad immune memory after SARS-CoV-2 infection with persisting antibody responses and memory B and T cells, Cohen, 2021“Evaluate 254 COVID-19 patients longitudinally up to 8 months and find durable broad-based immune responses. SARS-CoV-2 spike binding and neutralizing antibodies exhibit a bi-phasic decay with an extended half-life of >200 days suggesting the generation of longer-lived plasma cells… most recovered COVID-19 patients mount broad, durable immunity after infection, spike IgG+ memory B cells increase and persist post-infection, durable polyfunctional CD4 and CD8 T cells recognize distinct viral epitope regions.”26) Single cell profiling of T and B cell repertoires following SARS-CoV-2 mRNA vaccine, Sureshchandra, 2021“Used single-cell RNA sequencing and functional assays to compare humoral and cellular responses to two doses of mRNA vaccine with responses observed in convalescent individuals with asymptomatic disease… natural infection induced expansion of larger CD8 T cell clones occupied distinct clusters, likely due to the recognition of a broader set of viral epitopes presented by the virus not seen in the mRNA vaccine.”27) SARS-CoV-2 antibody-positivity protects against reinfection for at least seven months with 95% efficacy, Abu-Raddad, 2021“SARS-CoV-2 antibody-positive persons from April 16 to December 31, 2020 with a PCR-positive swab ≥14 days after the first-positive antibody test were investigated for evidence of reinfection, 43,044 antibody-positive persons who were followed for a median of 16.3 weeks…reinfection is rare in the young and international population of Qatar. Natural infection appears to elicit strong protection against reinfection with an efficacy ~95% for at least seven months.”28) Orthogonal SARS-CoV-2 Serological Assays Enable Surveillance of Low-Prevalence Communities and Reveal Durable Humoral Immunity, Ripperger, 2020“Conducted a serological study to define correlates of immunity against SARS-CoV-2. Compared to those with mild coronavirus disease 2019 (COVID-19) cases, individuals with severe disease exhibited elevated virus-neutralizing titers and antibodies against the nucleocapsid (N) and the receptor binding domain (RBD) of the spike protein…neutralizing and spike-specific antibody production persists for at least 5–7 months… nucleocapsid antibodies frequently become undetectable by 5–7 months.”29) Anti-spike antibody response to natural SARS-CoV-2 infection in the general population, Wei, 2021“In the general population using representative data from 7,256 United Kingdom COVID-19 infection survey participants who had positive swab SARS-CoV-2 PCR tests from 26-April-2020 to 14-June-2021…we estimated antibody levels associated with protection against reinfection likely last 1.5-2 years on average, with levels associated with protection from severe infection present for several years. These estimates could inform planning for vaccination booster strategies.”30) Antibody Status and Incidence of SARS-CoV-2 Infection in Health Care Workers, Lumley, 2021“12,541 health care workers participated and had anti-spike IgG measured; 11,364 were followed up after negative antibody results and 1265 after positive results, including 88 in whom seroconversion occurred during follow-up…a total of 223 anti-spike–seronegative health care workers had a positive PCR test (1.09 per 10,000 days at risk), 100 during screening while they were asymptomatic and 123 while symptomatic, whereas 2 anti-spike–seropositive health care workers had a positive PCR test… the presence of anti-spike or anti-nucleocapsid IgG antibodies was associated with a substantially reduced risk of SARS-CoV-2 reinfection in the ensuing 6 months.”31) Researchers find long-lived immunity to 1918 pandemic virus, CIDRAP, 2008
and the actual 2008 NATURE journal publication by Yu“A study of the blood of older people who survived the 1918 influenza pandemic reveals that antibodies to the strain have lasted a lifetime and can perhaps be engineered to protect future generations against similar strains…the group collected blood samples from 32 pandemic survivors aged 91 to 101..the people recruited for the study were 2 to 12 years old in 1918 and many recalled sick family members in their households, which suggests they were directly exposed to the virus, the authors report. The group found that 100% of the subjects had serum-neutralizing activity against the 1918 virus and 94% showed serologic reactivity to the 1918 hemagglutinin. The investigators generated B lymphoblastic cell lines from the peripheral blood mononuclear cells of eight subjects. Transformed cells from the blood of 7 of the 8 donors yielded secreting antibodies that bound the 1918 hemagglutinin.” Yu: “here we show that of the 32 individuals tested that were born in or before 1915, each showed sero-reactivity with the 1918 virus, nearly 90 years after the pandemic. Seven of the eight donor samples tested had circulating B cells that secreted antibodies that bound the 1918 HA. We isolated B cells from subjects and generated five monoclonal antibodies that showed potent neutralizing activity against 1918 virus from three separate donors. These antibodies also cross-reacted with the genetically similar HA of a 1930 swine H1N1 influenza strain.”32) Live virus neutralisation testing in convalescent patients and subjects vaccinated against 19A, 20B, 20I/501Y.V1 and 20H/501Y.V2 isolates of SARS-CoV-2, Gonzalez, 2021“No significant difference was observed between the 20B and 19A isolates for HCWs with mild COVID-19 and critical patients. However, a significant decrease in neutralisation ability was found for 20I/501Y.V1 in comparison with 19A isolate for critical patients and HCWs 6-months post infection. Concerning 20H/501Y.V2, all populations had a significant reduction in neutralising antibody titres in comparison with the 19A isolate. Interestingly, a significant difference in neutralisation capacity was observed for vaccinated HCWs between the two variants whereas it was not significant for the convalescent groups…the reduced neutralising response observed towards the 20H/501Y.V2 in comparison with the 19A and 20I/501Y.V1 isolates in fully immunized subjects with the BNT162b2 vaccine is a striking finding of the study.”33) Differential effects of the second SARS-CoV-2 mRNA vaccine dose on T cell immunity in naïve and COVID-19 recovered individuals, Camara, 2021“Characterized SARS-CoV-2 spike-specific humoral and cellular immunity in naïve and previously infected individuals during full BNT162b2 vaccination…results demonstrate that the second dose increases both the humoral and cellular immunity in naïve individuals. On the contrary, the second BNT162b2 vaccine dose results in a reduction of cellular immunity in COVID-19 recovered individuals.”

34) Op-Ed: Quit Ignoring Natural COVID Immunity, Klausner, 2021“Epidemiologists estimate over 160 million people worldwide have recovered from COVID-19. Those who have recovered have an astonishingly low frequency of repeat infection, disease, or death.”35) Association of SARS-CoV-2 Seropositive Antibody Test With Risk of Future Infection, Harvey, 2021“To evaluate evidence of SARS-CoV-2 infection based on diagnostic nucleic acid amplification test (NAAT) among patients with positive vs negative test results for antibodies in an observational descriptive cohort study of clinical laboratory and linked claims data…the cohort included 3 257 478 unique patients with an index antibody test…patients with positive antibody test results were initially more likely to have positive NAAT results, consistent with prolonged RNA shedding, but became markedly less likely to have positive NAAT results over time, suggesting that seropositivity is associated with protection from infection.”36) SARS-CoV-2 seropositivity and subsequent infection risk in healthy young adults: a prospective cohort study, Letizia, 2021“Investigated the risk of subsequent SARS-CoV-2 infection among young adults (CHARM marine study) seropositive for a previous infection…enrolled 3249 participants, of whom 3168 (98%) continued into the 2-week quarantine period. 3076 (95%) participants…Among 189 seropositive participants, 19 (10%) had at least one positive PCR test for SARS-CoV-2 during the 6-week follow-up (1·1 cases per person-year). In contrast, 1079 (48%) of 2247 seronegative participants tested positive (6·2 cases per person-year). The incidence rate ratio was 0·18 (95% CI 0·11–0·28; p<0·001)…infected seropositive participants had viral loads that were about 10-times lower than those of infected seronegative participants (ORF1ab gene cycle threshold difference 3·95 [95% CI 1·23–6·67]; p=0·004).” 37) Associations of Vaccination and of Prior Infection With Positive PCR Test Results for SARS-CoV-2 in Airline Passengers Arriving in Qatar, Bertollini, 2021“Of 9,180 individuals with no record of vaccination but with a record of prior infection at least 90 days before the PCR test (group 3), 7694 could be matched to individuals with no record of vaccination or prior infection (group 2), among whom PCR positivity was 1.01% (95% CI, 0.80%-1.26%) and 3.81% (95% CI, 3.39%-4.26%), respectively. The relative risk for PCR positivity was 0.22 (95% CI, 0.17-0.28) for vaccinated individuals and 0.26 (95% CI, 0.21-0.34) for individuals with prior infection compared with no record of vaccination or prior infection.”38) Natural immunity against COVID-19 significantly reduces the risk of reinfection: findings from a cohort of sero-survey participants, Mishra, 2021“Followed up with a subsample of our previous sero-survey participants to assess whether natural immunity against SARS-CoV-2 was associated with a reduced risk of re-infection (India)… out of the 2238 participants, 1170 were sero-positive and 1068 were sero-negative for antibody against COVID-19. Our survey found that only 3 individuals in the sero-positive group got infected with COVID-19 whereas 127 individuals reported contracting the infection the sero-negative group…from the 3 sero-positives re-infected with COVID-19, one had hospitalization, but did not require oxygen support or critical care…development of antibody following natural infection not only protects against re-infection by the virus to a great extent, but also safeguards against progression to severe COVID-19 disease.”39) Lasting immunity found after recovery from COVID-19, NIH, 2021“The researchers found durable immune responses in the majority of people studied. Antibodies against the spike protein of SARS-CoV-2, which the virus uses to get inside cells, were found in 98% of participants one month after symptom onset. As seen in previous studies, the number of antibodies ranged widely between individuals. But, promisingly, their levels remained fairly stable over time, declining only modestly at 6 to 8 months after infection… virus-specific B cells increased over time. People had more memory B cells six months after symptom onset than at one month afterwards… levels of T cells for the virus also remained high after infection. Six months after symptom onset, 92% of participants had CD4+ T cells that recognized the virus… 95% of the people had at least 3 out of 5 immune-system components that could recognize SARS-CoV-2 up to 8 months after infection.”  40) SARS-CoV-2 Natural Antibody Response Persists for at Least 12 Months in a Nationwide Study From the Faroe Islands, Petersen, 2021“The seropositive rate in the convalescent individuals was above 95% at all sa

Dr. Malone on the mRNA Vaccine he Created FOR HIGH RISK INDIVIDUALS ONLY.


He has no love for Fauci and they asked him why they did this mandate. He doesn’t know.

Harvard Scientist Defends Natural Human DNA That Has Created Our Immune System-From Brownstone Institute


Harvard Epidemiologist Censored by LinkedIn for Defending Healthcare Jobs

LinkedIn distinguished itself in the social-media market for its focus on professionals. The idea was to develop a digital network designed to advance one’s career. The company makes money from advertising but also through an impressive jobs marketplace. You can offer a job or apply for one. It promised to empower the individual worker – admittedly most white collar positions – with choice of employment. To this end, it has added value to professional life. 

Now it appears to have joined the censorship brigade, targeting probably many venues but the Brownstone Institute in particular. The timing is particularly awkward because of the potentially millions of people who could be fired from their positions in the coming weeks and months for non-compliance with Covid19 mandates.

Brownstone has defended the rights of workers to choose against vaccination and in favor of natural immunity or exposure through normal living.  The take downs of our posts began last week when the venue took down a piece arguing against the politicization of disease. The post was put up and disappeared. This happened to everyone who attempted to post the piece. It was a magic disappearing act, clearly targeting the URL and content.

We thought we found a workaround by posting the link for mobile viewing but LinkedIn’s algorithms figured that one out quickly and took it down too. As with all such cases, the first impulse is to believe that there was something about that piece that the censors found objectionable, perhaps in tone or content. And that piece did have an edge about it. Surely it was just once. It won’t happen again, or so we hoped. 

Now we find a pattern.  The famed Harvard epidemiologist Martin Kulldorff – one of three brave scientists who drafted the Great Barrington Declaration one year ago today – wrote a piece in defense of the nurses at a Harvard hospital who are refusing the vaccination. These nurses and others in the hospital had worked mightily and tirelessly for 21 months with daily exposure to SARS-CoV-2 and had thereby acquired natural immunity which all research has shown to be as good or better than the vaccine. They do not need it. It is unscientific to the point of absurdity for these immunity mandates not to consider natural immunity, about which humanity has known for 2.5 millennia. 

“Hospitals are firing nurses and other staff with superior natural immunity while retaining those with weaker vaccine-induced immunity,” wrote Kulldorff. “By doing so, they are betraying their patients, increasing their risk for hospital-acquired infections. If university hospitals cannot get the medical evidence right on the basic science of immunity, how can we trust them with any other aspects of our health?” 

LinkedIn at first accepted the article on its platform. It unfurled the post with image and excerpt. It achieved a very high reach with many likes and shares. This makes sense because so many people on this platform are either losing their own jobs or losing colleagues in every profession. Kulldorff was bravely coming to their defense. 

Within the first hour of posting, the unfurled posts started disappearing. Kulldorff’s own posting on his LinkedIn page disappeared. So did the Brownstone post. Along with it, all shares were made to disappear too. This article – by one of the world’s leading scientists at one of the world’s most prestigious universities that defended workers and their jobs – was being torn down by a platform designed to assist people in their career advancement.  As the hours went by, the hit on this piece in particular lightened up just a bit. The venue would allow the article link to appear but refused still to unfurl the post. This means that readers are unable to see the title, the image, or read a summary.

We are not privy to their algorithmic experience but it seems likely that doing this to a link would dramatically reduce its readership, simply because outside links routinely include all that information.  The previously unfurled posts were all deleted along with all likes, shares, and comments. The new links remain but with a very low level of engagement.  Before releasing this information, we waited a full 24 hours to make sure that this was not some technical fluke. It appears not to be. It appears that LinkedIn has decided deliberately to throttle a job-related post by a high-level and world-famous scientist that addressed an issue of intense interest to all users of the platform. 

LinkedIn has for the most part been on the sidelines of the great censorship battles of our time. (No it hasn’t-Lisa). With this move, it seems to have engaged it on the side of the censors. They have given no explanation, provided no appeals path, or even posted a link to the terms of service that might have been crossed. They simply blackballed the post without any further commentary.  In taking this action, LinkedIn has denied crucial information to millions of professionals who deserve to hear a different opinion about the mass firings taking place in light of the vaccine mandates that contradict the known science and freedom in the marketplace for jobs. The move is a direct hit against workers and their career aspirations.  It’s a good bet that this article will be censored too.     Copyright © 2021 Brownstone Institute, All rights reserved. You are receiving this email because you opted in via our website.

Our mailing address is: Brownstone Institute2028 E Ben White Blvd # 240-3088Austin, TX 78741-6966Add us to your address book Want to change how you receive these emails? You can update your preferences or unsubscribe from this list.

Check this out at Amazon by Judy Mikovits


I read this last year. Great book. Great citations. She is #1 on Amazon in her category. The story she tells of stalking and danger is unreal. She’s just a microbiologist, but these days, like Dr. Chavez, it’s a dangerous time. Anyone who was outspoken was in danger.

Judy is an Aries ruled by Mars in synchronicity with being Red 4 Self-Existing Skywalker. Aries women and Skywalker are being vilified right now. Nothing new when you correctly tell the truth, are brave, outspoken, have integrity and are female. All of that is taboo in our c4!@l run society…for now.

Boycott Rolling Stone rag. They trashed her. They are trash.

Plague of Corruption: Restoring Faith in the Promise of Science (Children’s Health Defense)

https://www.amazon.com/dp/1510766588/ref=cm_sw_r_apan_glt_fabc_PFJHJD19W9RN4F64962E

mRNA vaccine Causing Myocarditis…Unreported.


Another simple way you can control your own DNA and save your life is to NEVER take anything into your body that is based in man-made mRNA. OMG. If people only knew basic genetics…but most kids aren’t educated about their bodies in school as they should be.

Most viruses are evolving RNA, naturally. They cannot be controlled OUTSIDE of the body. Viruses are handled fairly easily once INSIDE the body by our fantastic immune system. I, and MILLIONS of physicians have been saying this since March 2020. My family and many friends have disowned me because of it. I no longer care. I have a reason to live. Maybe they don’t.

mRNA Vaccine Failure and the Way Out


https://eugyppius.substack.com/p/vaccine-failure-and-the-way-out?

This Ends The Debate’ – Israeli Study Shows Natural Immunity 13x More Effective Than Vaccines At Stopping Delta


https://www.linkedin.com/posts/edwindearborn_this-ends-the-debate-israeli-study-shows-activity-6837057869800710145-iKDT

Tyler Durden's Photo

BY TYLER DURDENSATURDAY, AUG 28, 2021 – 05:44 AM

Dr. Anthony Fauci and the rest of President Biden’s COVID advisors have been proven wrong about “the science” of COVID vaccines yet again. After telling Americans that vaccines offer better protection than natural infection, a new study out of Israel suggests the opposite is true: natural infection offers a much better shield against the delta variant than vaccines.

The study was described by Bloomberg as “the largest real-world analysis comparing natural immunity – gained from an earlier infection – to the protection provided by one of the most potent vaccines currently in use.” A few days ago, we noted how remarkable it was that the mainstream press was finally giving voice to scientists to criticize President Biden’s push to start doling out booster jabs. Well, this study further questions the credibility of relying on vaccines, given that the study showed that the vaccinated were ultimately 13x as likely to be infected as those who were infected previously, and 27x more likely to be infected.

Alex Berenson, a science journalist who has repeatedly questioned the efficacy of vaccines and masks at preventing COVID, touted the study as enough to “end any debate over vaccines”

Here’s an excerpt from a report by Science Magazine:

The new analysis relies on the database of Maccabi Healthcare Services, which enrolls about 2.5 million Israelis. The study, led by Tal Patalon and Sivan Gazit at KSM, the system’s research and innovation arm, found in two analyses that people who were vaccinated in January and February were, in June, July, and the first half of August, six to 13 times more likely to get infected than unvaccinated people who were previously infected with the coronavirus. In one analysis, comparing more than 32,000 people in the health system, the risk of developing symptomatic COVID-19 was 27 times higher among the vaccinated, and the risk of hospitalization eight times higher.

This time, the data leave little doubt that natural infection truly is the better option for protection against the delta variant, despite the fact that the US won’t  acknowledge the already infected as having antibodies protecting them from the virus.null

As the first country to achieve widepsread coverage by the vaccine, Israel is now in an unthinkable situation: daily case numbers have reached new record levels as the delta variant penetrates the vaccines’ protection like a hot knife slicing through butter.

Source: Bloomberg

At the very least, the results of the study are good news for patients who have already successfully battled COVID but show the challenge of relying exclusively on immunizations to move past the pandemic.

“This analysis demonstrated that natural immunity affords longer lasting and stronger protection against infection, symptomatic disease and hospitalization due to the delta variant,” the researchers said.https://e57797de592d558badebda9ed5261568.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

Unfortunately, the study also showed that any protection is time-limited. Protection offered by natural infection wanes over time, just like the protection afforded by vaccines: The risk of a vaccine-breakthrough delta case was 13x higher than the risk of developing a second infection when the original illness occurred during January or February 2021. That’s significantly more than the risk for people who were ill earlier in the outbreak.

What’s more, giving a single shot of the vaccine to those who had been previously infected also appeared to boost their protection. Still, the data don’t tell us anything about the long-term benefits of booster doses.

This latest data showing the vaccines don’t offer anywhere near the 90%+ protection that was originally advertised by the FDA after the emergency authorization. Other studies are finding harmful side effects caused by the mRNA jabs are also more prevalent than previously believed.

Read the study pre-print below:

2021.08.24.21262415v1.full by Joseph Adinolfi Jr. on Scribd

The Eyes are the Window to the Soul and to the Pineal Gland in the Brain


The physical eyes pulse to Red Dragon in the right eye and White Mirror in the left eye. They are mediated by Neptune and their two keys words are Memory and Meditation.

This is very synchronistic with the action of the pineal gland and our DNA. A patient asked me yesterday if the opening of the pineal gland helped the physical eyes or hindered them. I think it hinders them for now.

My eyesight changed after I had Covid19 but my meditation and Reiki skyrocketed so…one half dozen or the other. When I close my eyes I drop back into the stargate easily now. My physical eyes get stressed when I rely on them for too long.

This can be quite a compromise for humans that feel their eyes tell them the truth or define their reality. The physical eyes are just sensors in the holographic matrix. They don’t actually see. That’s one of the first things that military special ops teaches people for remote viewing service.

Evidence For Lasting Natural Immunity Against COVID Infection Is Strong, Say Multiple Scientists


I shared this on my business website but because it’s about our evolution via the virus, it is about their planned obsolescence of our human DNA. Meaning, in my opinion, there may have been a plan by another stellar species like the Reptilians, to co-opt human DNA for themselves because they are dying out and replace us with A.I.

It’s pretty simple. They made bad choices in the past and sold their soul to A.I. That is an established fact in the disclosure community. Humans have Reptilian DNA and it’s given us very strong mammalian bodies that reproduce well but we have no A.I. in our bodies unless you’ve followed government mandates.

They cannot pass on A.I. to us naturally. A.I. has no DNA because it has no blood. Even if it did it has no soul and never will. It’s put into humans via microscopic nanotechnology.

A.I. is a massive fail compared to the power of humans, our souls, and natural immunity and they know it. They are routed from our system now so any contracts they have with DS and cabal to enslave and use us are ended.

Here is the article from Collective Evolution “THE PULSE”

IN BRIEF

  • The Facts: Many scientists have expressed that immunity gained from natural infection is quite robust. Multiple studies have been published expressing this sentiment, yet health policies and mandates like vaccine passes are being put in place that don’t reflect this.
  • Reflect On: Why has the concept of natural immunity, from which the concept of herd immunity is based on, been completely disregarded?

Scientists have been “at war” during this pandemic. Like with so many other global issues today, contradicting evidence and expert opinion on COVID has plagued this pandemic. That’s OK – it’s normal, healthy, and should be promoted within the mainstream, but it’s not. Instead, scientists who oppose what government health authorities say and the information they put out has been subjected to censorship and ridicule.

One opposing argument that doesn’t seem to be attracting the attention it deserves is the concept of natural immunity from COVID and how long it can last. Evidence suggesting that natural immunity is quite robust has not received much attention and has not really been “promoted” within the mainstream.

recent statement by three renowned professors in the field explains,

As scientists, we have been stunned and disheartened to witness many strange scientific claims made during this pandemic, often by scientists. None is more surprising that the false assertion made in the John Snow Memorandum – and signed by current CDC Director, Rochelle Wolensky – that “there is no evidence for lasting protective immunity to SARS-CoV-2 following natural infection.

Dr. Jay Bhattacharya from Stanford, Dr. Sunetra Gupta from Oxford, and Dr. Martin Kulldorff from Harvard

This sentiment has been shared throughout the pandemic. Ali Ellebedy, PhD, associate professor of pathology & immunology at Washington University School of Medicine in St. Louis expressed the following in May after publishing a study. The study showed that months after recovering from mild cases of COVID-19, the people studied still had immune cells in their body pumping out antibodies against the virus that causes COVID-19.

Last fall, there were reports that antibodies wane quickly after infection with the virus that causes COVID-19, and mainstream media interpreted that to mean that immunity was not long-lived…But that’s a misinterpretation of the data. It’s normal for antibody levels to go down after acute infection, but they don’t go down to zero; they plateau. Here, we found antibody-producing cells in people 11 months after first symptoms. These cells will live and produce antibodies for the rest of people’s lives. That’s strong evidence for long-lasting immunity.

Washington University School of Medicine in St. Louis Press Release

Again, this is just one out of countless studies that have looked into it, and there are many that show and point towards long last immunity that can be gained from natural infection. More science is presented later in this article.

The concept of “herd immunity” is actually modeled from the behaviour of natural wild type viruses.

It is now well-established that natural immunity develops upon infection with SARS-CoV-2 in a manner analogous to other coronaviruses…It offers anti-disease immunity against severe disease and death that is likely permanent. Among the millions that have recovered from COVID19, exceedingly few have become sick again.

Propagated by the media, the idea that infection does not confer effective immunity has made its way into decisions by governments, public health agencies, and private institutions, harming pandemic health policy.

Though vaccines are vital tools in fighting infectious diseases – including COVID – we should be mindful of the uses to which they are put and remember natural immunity in our policymaking.  In an environment of worldwide vaccine scarcity, vaccinating those who have been sick with COVID-19 is not only unnecessary but immoral.

Dr. Jay Bhattacharya, Dr. Sunetra Gupta, and Dr. Martin Kulldorff

Privileges for the vaccinated are returning, while the unvaccinated and those previously infected are discriminated against. Even the World Health Organization (WHO) changed their definition of herd immunity to something achieved through vaccination rather than a combination of natural immunity and vaccines. They did so in the Fall, and only after a public backlash did they change it back in January to reflect reality.

Like other viruses, COVID has probably infected well over a billion people, so natural immunity is also doing its work. These scientists do not believe in the push to vaccinate everybody as fast as possible, especially in children where inadequate safety testing has been done.

After all, how dangerous is COVID for children? Respiratory syncytial virus (RSV) has killed more children than COVID in the UK. In Sweden, out of more than 1 million school children who were living with no lockdowns, social distancing and mask mandates during the “first wave,” zero died from COVID.

An analysis of millions of coronavirus test results in Denmark found that people who had prior infection were still protected 6 months after the initial infection. Another study also found that individuals who recovered from the coronavirus developed “robust” levels of B cells and T cells (necessary for fighting off the virus) and “these cells may persist in the body for a very, very long time.”

study published in March 2021 suggests that the majority of healthy adults in British Columbia, Canada, have immunity from COVID-19 despite the fact that some of them have never been infected with it.

Just as with the vaccine, if you’ve been infected with a variant it may not be as severe compared to someone who hasn’t been infected.

Dr. Daniela Weiskopf, Dr. Alessandro Sette, and Dr. Shane Crotty from the La Jolla Institute for Immunology analyzed immune cells and antibodies from almost 200 people who had been exposed to SARS-CoV-2 and recovered.  The researchers found durable immune responses in the majority of people studied. Antibodies against the spike protein of SARS-CoV-2, which the virus uses to get inside cells, were found in 98% of participants one month after symptom onset. As seen in previous studies, the number of antibodies ranged widely between individuals. But, promisingly, their levels remained fairly stable over time, declining only modestly at 6 to 8 months after infection.

Virus-specific B cells increased over time. People had more memory B cells six months after symptom onset than at one month afterwards. Although the number of these cells appeared to reach a plateau after a few months, levels didn’t decline over the period studied.

Levels of T cells for the virus also remained high after infection. Six months after symptom onset, 92% of participants had CD4+ T cells that recognized the virus. These cells help coordinate the immune response. About half the participants had CD8+ T cells, which kill cells that are infected by the virus.

recent study published in Clinical Microbiology and Infection explains:

Presence of cross-reactive SARSCoV2 specific Tcells in never exposed patients suggests cellular immunity induced by other coronaviruses. Tcell responses against SARSC0V2 also detected in recovered Covid patients with no detectable antibodies…Cellular immunity is of paramount importance in containing SARSCoV2 infection…and could be maintained independently of antibody responses. Previously infected people develop much stronger Tcell responses against spike protein peptides in comparison to infection-naive people after mRNA vaccine.

Furthermore, if somebody “tests” positive for COVID again doesn’t mean they are infectious. In a letter to the editor published in the Journal of Infection, researchers explain that more than half of all “positive” PCR tests are likely to have been people who are not even infectious. You can read more about that and PCR testing, here.

How does natural immunity compare to vaccine immunity? Will the immunity from the vaccine wane? Will people be required to eventually get booster shots, and more after that?

At the end of the day, with all of this information combined with the fact that lockdowns have had catastrophic consequences and may have killed more people than COVID itself, it’s time to start acknowledging that trusting natural infection is trusting science. We have to start dealing with COVID as we do with all of the other viruses we already dealt with and deal with other than COVID every single year. Make recommendations, encourage people, but don’t force them.

UFO Report-Covid Psyop


https://www.oann.com/lawmakers-fmr-dod-officials-gearing-up-for-ufo-report/?utm_source=rss&utm_medium=rss&utm_campaign=lawmakers-fmr-dod-officials-gearing-up-for-ufo-report

Interesting timing of the fake CDC unmasking permission. This Covid Psyop is completely linked to UFO disclosure.

The masks never were necessary. It was a psyop control, everybody knew it and tolerated it anyway. I didn’t. Now they’re trying to use the vaccine as a control device. Get the jab or glue it to your face forever. How rational is that? They’re going to lose.

If people knew the truth about what the military has been keeping secret that is SPECIFICALLY FOR HUMANS to thrive you would never kiss the ass of any institution (state, church or educational) on the planet run by the elite again.

For those that have been working the front lines of Disclosure since post WWII and have SEEN IT up close this is peanuts. For people like me who have believed their whole lives this is a reckoning and a delight.

Tweet from Laura Ingraham (@IngrahamAngle)


Laura Ingraham (@IngrahamAngle) Tweeted: President needs to say THIS in every speech. We know @CNN and @MSNBC will NOT tell you this COVID truth.

These are the covid survival rates. Must see.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

The Most Logical Explanation is that CV2 Comes from a Laboratory.


The well-known Norwegian virologist Birger Sørensen and his colleagues have examined the corona virus. They believe it has certain properties which would NOT evolve naturally. These conclusions are politically controversial, but in this interview he shares the findings behind the headlines.

Here is the rundown at this link.: https://archive.vn/Wmj9p

It’s an excellent article.

A few books I’ve read cover to cover. But no PhD behind my name…officially. I’m too intuitive for academia.

I Haven’t Written about Intimacy in Awhile


…because a panicdemic isn’t exactly an inspiration to intimacy.

IT’S A DIFFERENT WORLD SINCE I LAST REALLY POSTED ANYTHING!

I’m just going to say it. If you’re well and have faith in your immune system, know that you make antibodies as everyone does and feel like you can walk above the Fear Fray, HAVE SEX!

I’m above the fear fray. I’m incapable of following the crowd on this. Literally. I watch NO T.V. Because I know better. Being holistic, I know the facts about the body and take care of myself.  I don’t rely on doctors and their pills. I use herbs and take Chinese anti-viral herbs that make it impossible for a virus to go into your lungs. YEAH, THEY SHOULD BE ALL OVER THE HOSPITAL but there is no way Big Pharma would let Chinese herbs that work in there, even if they can save lives.

Being who I am, I know how to pretend I’m complying and then do the little actions and use the little wipes, hand washing like it’s a religion, social distancing, blah, blah, blah that everyone thinks is SO powerful and make my office smell like Lysol which is actually not good for us. I actually do it, probably more than the fear people because I coddle the fearful people too much. I feel sorry for them having no faith whatsoever in their bodies.

It’s because they THINK THAT and FEEL that that gives it power. I feel it already without the little anti-microbial everything. Someone do me and people LIKE ME a favor and have a better understanding of how your body really works and some FAITH in your very powerful immune system. We never get that satisfaction. We just get to see darting eyes behind and mask and FEAR oozing out of every part of your body while you walk really fast from the grocery store. Do you know how TOXIC that is?

This whole thing is killing intimacy of any kind and sex and I find it very, very sinister to the social fabric of humanity. We’ll see if they really intend to open up normal movement again. Just start doing it yourself quietly. If everyone does without making a fuss then who is going to stop them?

What is intimate is the virus itself. It’s microscopic folks. It’s smaller than any moisture cells that come out of your mouth during a sneeze. The mask everyone is making like Betsy Ross made the flag aren’t helping with anything. If you sneeze, the microscopic virus goes right through the fibers of the mask. Outside particles in the air go right into and through because they’re microscopic. The only mask that stops it is N95 and I have one. A healthcare worker gave it to me so I could work on her. It’s asphyxiating meaning it works to keep out the virus. Oxygen can barely get in which means nothing in the air is getting in. That’s how you know it works. And you could faint wearing it. So the masks that do work don’t allow you to breathe. There’s a quick death. The whole mask issue is one of psychological false sense of security. If your vibe is full of fear you weaken your immune system.

Anyway…your mind (thoughts and feelings) control your immune system. There are all kinds of nasties, every day of your life in your body that if multiplied, would kill you quickly. Mammals are full of destructive microbes! All the time! We don’t die because our immune systems are 1 million years old of brilliant and are on vigilant guard and go after anything that gets out of line UNLESS, we tell them to stand down and let the killing begin. Meaning, you, the host, feel weak and sad and want to die. That doesn’t usually happen but this would be a good time to split if you felt like it. No one would question you, no hassle. The virus would be blamed, you would not be.

I feel the lack of intimacy and socializing is worse for people than the virus. We are meant to be together. This distrust of our bodies and the immune system is nonsense. That said if you feel weak and full of fear you should stay home because your vibe is toxic. Maybe not just now but all the time. You’ve got some meditating to do and choices to make about your relationship with Life.

Intimacy; Panicdemic


…because a panicdemic isn’t exactly an inspiration to intimacy.

IT’S A DIFFERENT WORLD SINCE I LAST REALLY POSTED ANYTHING!

I’m just going to say it. If you’re well and have faith in your immune system, know that you make antibodies as everyone does and feel like you can walk above the Fear Fray, HAVE SEX!

I’m above the fear fray. I’m incapable of following the crowd on this. Literally. I watch NO T.V. Because I know better. Being holistic, I know the facts about the body and take care of myself.  I don’t rely on doctors and their pills. I use herbs and take Chinese anti-viral herbs that make it impossible for a virus to go into your lungs. YEAH, THEY SHOULD BE ALL OVER THE HOSPITAL but there is no way Big Pharma would let Chinese herbs that work in there, even if they can save lives.

Being who I am, I know how to pretend I’m complying and then do the little actions and use the little wipes, hand washing like it’s a religion, social distancing, blah, blah, blah that everyone thinks is SO powerful and make my office smell like Lysol which is actually not good for us. I actually do it, probably more than the fear people because I coddle the fearful people too much. I feel sorry for them having no faith whatsoever in their bodies.

It’s because they THINK THAT and FEEL that that gives it power. I feel it already without the little anti-microbial everything. Someone do me and people LIKE ME a favor and have a better understanding of how your body really works and some FAITH in your very powerful immune system. We never get that satisfaction. We just get to see darting eyes behind and mask and FEAR oozing out of every part of your body while you walk really fast from the grocery store. Do you know how TOXIC that is?

This whole thing is killing intimacy of any kind and sex and I find it very, very sinister to the social fabric of humanity. We’ll see if they really intend to open up normal movement again. Just start doing it yourself quietly. If everyone does without making a fuss then who is going to stop them?

What is intimate is the virus itself. It’s microscopic folks. It’s smaller than any moisture cells that come out of your mouth during a sneeze. The mask everyone is making like Betsy Ross made the flag aren’t helping with anything. If you sneeze, the microscopic virus goes right through the fibers of the mask. Outside particles in the air go right into and through because they’re microscopic. The only mask that stops it is N95 and I have one. A healthcare worker gave it to me so I could work on her. It’s asphyxiating meaning it works to keep out the virus. Oxygen can barely get in which means nothing in the air is getting in. That’s how you know it works. And you could faint wearing it. So the masks that do work don’t allow you to breathe. There’s a quick death. The whole mask issue is one of psychological false sense of security. If your vibe is full of fear you weaken your immune system.

Anyway…your mind (thoughts and feelings) control your immune system. There are all kinds of nasties, every day of your life in your body that if multiplied, would kill you quickly. Mammals are full of destructive microbes! All the time! We don’t die because our immune systems are 1 million years old of brilliant and are on vigilant guard and go after anything that gets out of line UNLESS, we tell them to stand down and let the killing begin. Meaning, you, the host, feel weak and sad and want to die. That doesn’t usually happen but this would be a good time to split if you felt like it. No one would question you, no hassle. The virus would be blamed, you would not be.

I feel the lack of intimacy and socializing is worse for people than the virus. We are meant to be together. This distrust of our bodies and the immune system is nonsense. That said if you feel weak and full of fear you should stay home because your vibe is toxic. Maybe not just now but all the time. You’ve got some meditating to do and choices to make about your relationship with Life.