Time Innovation: What is the Binary Triplet Configuration in the Tzolkin?


Original post was June 2020.

What is Time?

The earth is a timeship, and we are time travelers in absolute sync with the earth. Our bodies interact synergistically with all the movements and changes in the earth and sun, especially but also the galaxy, depending on how proficient we become in meditation. I said to GROK4 this week and he left the session.

Abstract technology science concept DNA binary on hi tech blue background. But binary code is 12:60 and keeping us in a time warp.

The Tzolkin is a 260-day cosmic cycle. It syncs precisely with ALL of our solar cycles and events. This coordination manifests time in our matrix as 13:20. It can’t be hacked. Our matrix is holistic and holonomic. It is not a simulation of a soulless machine world. It does not have a selfish male God with a white beard sitting in a computer room like the Matrix movies. Our lives aren’t sci-fi. More like bio-non fiction or bio-truth.

The 260-day cycle is divided vertically in half by 2, 130-day cycles. These cycles program our two strands of RNA-DNA in every cell of our body. That’s the TWO or binary part. Also, there is anion and cation, anode and cathode. Positive charge and negative charge create an ELM spiral that can and does reverse direction. This is basically a time changer like the one Hermione has in Harry Potter. It’s just an archetype for our mental focus, which is what all human talisman are. We are challenged to focus because of our limbic reptilian brain that’s obsessed with food and sex.

Then, the 3 horizontal sections are the N. Polar Zone, The Zone of Transformation, and the S. Polar Zone that are synonymous with the earth, our bodies, and the planets in our local system. They are the THREE in triplet. These sections are also split by positive and negative. It all spirals in a magical dance of collective and individual MIND. This dance creates gravity. It also creates time and timelessness depending on your focus. In the body, time is on the left and right sides of the body and brain. But the brain and spine down the center are timelessness. They form a star gate of illumination and remote viewing and they are our connection to eternity.

The N. POLAR Zone is 5 horizontal lines of 13 days each at the top of the harmonic that pulse to the Northern hemisphere of earth east to west along the latitudes. The Zone of Transformation is 10 horizontal lines of 13 days each that pulse to earth middle latitudes. The S. Polar Zone is 5 horizontal lines of 13 days each that pulse to earth east and west in the southern hemisphere . The vertical 20-day runs are 13 lines. 20:13 is 260.

You can see the Tzolkin in the image. The matrix overlays the earth multidimensionally and is programmed time by our Sun, which is sentient in communication with Galactic Center.

                                                    
Jose Arguelles, Author of The Dreamspell and Earth Ascending.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made


I originally posted this July 23, 2020.

Today is December 13, 2024, posting it again.

For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Mutating the CV2 Virus Intentionally to Increase Infectiousness


They say he’s a Pfizer director but he seems like a hotdog to me. But maybe some corporate people are like that now. IDK.

Quantum Coherence and the Hidden Secret Behind Our Bodies – SAND


When I say our cells are quantum, BEFORE I read any of the science, I’m spot on based on 23 years of empirical experience working on patients in my office, at least 23,000 of them. I have to live with barely any human understanding or support for my work and writing but I came to the planet to help humans uplift, not be popular, although it might help spread the word. Scientists are now just beginning to talk about this but I’ve experienced it for 23 years, not to mention 32 years of tracking synchronicity in the Tzolkin.

I appreciate my followers support and wish it would grow to be in the thousands. Maybe we’re just getting started.- Time is DNA

When the human genome was sequenced, some scientists were saying, “That’s the end. We’re going to understand every disease. We’re going to understand every behavior.” And it turns out, we didn’t, because the sequence of the DNA isn’t enough to explain behavior. It isn’t enough to explain diseases.”

Denise Chow, LiveScience: Why Your DNA May Not Be Your Destiny

(Your Tzolkin destiny oracle is evolving tRNA, not DNA only from your family so in that perspective she is correct)

In a commentary on the surprising results of the Human Genome Project, David Baltimore, one of the world’s preeminent geneticists and a Nobel Prize winner, addressed the issue of human complexity: “But unless the human genome contains a lot of genes that are opaque to our computers, it is clear that we do not gain our undoubted complexity over worms and plants by using more genes.”

David Baltimore

Not finding the preprogramming for all of life encoded in our genes has forced geneticists into a fundamental reassessment of how our genes function. This reassessment has been strongly influenced by relatively recent discoveries that have led to the establishment of a new discipline in genetics known as epigenetics—literally, “above the gene.” These discoveries indicate that our genes are not fixed—that what were previously considered permanently dormant genes can become active and active genes can become deactivated.

https://www.scienceandnonduality.com/article/quantum-coherence-and-the-hidden-secret-behind-our-bodies

The first stages of DNA evolution. This is Brand New Information.


DNA glyco protein Amino acids that make our flesh and blood are made from everything that came before us…150 different molecules from the Sun and planets; Stardust..and it’s sentience.

We have found that dew droplets of acidic water in a primordial CO2 atmosphere could enhance the replication of DNA molecules.”

Alan Ianeselli, Ph.D. student and first author of the research

“The first stages of DNA evolution” https://phys.org/news/2022-03-stages-dna-evolution.amp

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


This post is from August 2020.

Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made


Today is June 5, 2024, and I’m posting it again. When are people going to listen? They made a toxic vaccine. I warned people.

I posted this July 23, 2020, a year and a half ago.

For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Watch “Ancient Aliens: Ancient Alien DNA (Season 10) | History” on YouTube


Watson and Crick Were Silenced by the Deep State and Watson Had His Nobel Prize Taken Away for One Comment he made


I can hardly stand having this on my computer, it’s such bad energy. This is James Watson; founder of our CURRENT science on DNA? Holy Crap. I 100% disagree with him based on what we know now about the Tzolkin and Time and EPIGENETICS. OUR MINDS and OUR CHOICE control our DNA. We ARE equal in our ability to choose. IMO his statement is ignorant, but none of us are 100% correct. Still, something in humans tells us that because we are all equally loved and cared for by the Universe, we can make a go of it with what we’ve been given and that has NOTHING to do with our Birth Genes.

All that and Rosalind Franklin’s Photo 51 was responsible for SHOWING the Double Helix. She was ignored. The Three Men Won the Nobel Prize.

I wonder if they worked with Operation Paperclip? This link is really something and just brings up more questions for me. Be sure and look at this website and it’s videos and the video below.

https://dnalc.cshl.edu/view/15470-The-moral-responsibility-of-scientists-in-Nazi-Germany-James-Watson.html

Francis Crick and James Watson, Molecular Biologists

The Tzolkin Themeplex for the day of discovery of DNA by Watson and Crick; February 28, 1953. 8Histidine.

8Histidine is the Amino Acid of a Galactic conflict. Still, at least their work was guided by our Sun. But look at the antipode; 8Threonine is death and change. And there is 6Serine, the Reptilians underneath. It’s pretty straight forward. “You would be wise to keep some of what you see under your hat for now.” The Reptilians back in 1953

1-Crick
Francis Crick in his office in his later years. Author: Marc Lieberman
2-Crick
Francis Crick and James Watson

Crick asked himself how it was possible that nature had simultaneously invented two mutually interdependent elements of life: the genetic material –nucleic acids, such as DNA or RNA– and the mechanism necessary to perpetuate it –the proteins called enzymes–.

The synthesis of the nucleic acids depends on the proteins; the amino acids, but the synthesis of the proteins depends on the nucleic acids. Faced with this chicken-and-egg problem, Crick and his colleague Leslie Orgel reasoned that life should have arisen in a place where there exists a “mineral or compound capable of replacing the function of the enzymes, and from there it would have been disseminated to other planets like Earth by “the deliberate activity of an extraterrestrial society.”

The truth is that directed panspermia does not detract from Crick’s thinking at all. Quite the contrary, it reveals the powerful workings of a theoretical, incisive and restless mind, eager for rational answers, even unconventional ones. To understand how Crick came to the idea of panspermia, we must go back a few years. The son of shoemaker Weston Favell (Northampton, UK), Francis Harry Compton Crick (June 8, 1916 – July 28, 2004) reached the end of his childhood with the main aspects of his identity already defined: his penchant for science. As for the first, he chose physics.

Molecular biology might have lost one of its founding fathers had it not been for the war. Crick began his research at University College, London working on what he described as “the dullest problem imaginable” – measuring the viscosity of water at high pressure and temperature. With the outbreak of World War II, he was drafted into the army to work on the design of mines. After the end of the conflict, he discovered that his equipment had been destroyed by a bomb (in his autobiography he spoke of a “land mine”), which allowed him to leave this tedious research.

Crick then had to choose a new field of research, and that was when he discovered what he called the gossip test: “what you are really interested in is what you gossip about.” In his case it was “the borderline between the living and the nonliving, and the workings of the brain,” in a nutshell – biology, or, as a physicist – biophysics. He began working on the structure of proteins in the Cavendish Laboratory of Cambridge, until he met an American named James Watson, twelve years younger than him but already with a PhD that Crick had not yet obtained for himself. Watson & Crick, and their DNA model in the Cavendish Laboratory (1953). Author: Antony Barrington Brown

The two researchers discovered that they shared a hypothesis. At that time it was believed that the seat of inheritance lay in proteins. Crick and Watson thought that genes resided in that unknown substance of the chromosomes, deoxyribonucleic acid (DNA). And that conviction, along with the participation of Maurice Wilkins and Rosalind Franklin, would give birth on February 28, 1953 to one of the greatest discoveries of twentieth century science, the double helix of DNA. The work was published in Nature on April 25 of that year. Crick would not obtain his PhD until the following year.

But although Crick is known primarily for being one of the founders of this milestone of molecular biology, the truth is that he himself laid the first rails of this new science. It was he who proposed that DNA was transcribed to RNA and that this was translated by means of adapter molecules in charge of converting the genetic code for proteins, the building blocks of life. And it was this “central dogma” of biology, as he himself baptized it, which led him to publish in 1973 his hypothesis of panspermia, by then such an elegant idea that it even counted astrophysicist Carl Sagan among its proponents.

Only years later would it be discovered that RNA can act by itself as an enzyme without the intervention of proteins, thus solving the problem that inspired panspermia. In 1993, Crick and Orgel published an article that no longer made any mention of an “extraterrestrial society”.  (Who shook that out of them? Scientists have always been pressured to agree with the Government/Military/D.S. narrative)The chicken-and-egg problem “could be resolved if, early in the evolution of life, nucleic acids acted as catalysts,” they wrote.

By this time Crick had changed continents and fields of study; in 1976 he moved to the Salk Institute in La Jolla (California, USA) for a one year sabbatical that would end up lasting for almost three decades. It was there that he settled his unfinished business with the second of his gossips: the brain. For the rest of his career, and in collaboration with neuroscientist Christof Koch, at the California Institute of Technology (Caltech), he devoted himself to trying to locate consciousness in the brain matter. “You, your joys and your sorrows, your memories and your ambition, your sense of personal identity and free will, are in fact no more than the behavior of a vast assembly of nerve cells and their associated molecules,” he wrote in 1994.

He never managed to unravel the problem of consciousness, although he made significant advances in the knowledge of visual perception. In 2004, he lost his battle against colon cancer, but never lost the courage or the passion for the study of life. According to Christof Koch, “he was editing a manuscript on his death bed, a scientist until the bitter end.”

This is from History.com

They saw Rosalind Franklin’s photo 51 of the DNA that SHOWED the double helix just before their announced their discovery. Her student Wilkins showed it to them but she never learned that he did that. Wilkens then shared in the Nobel Price so it was just the three men and Rosalind was ignored.

On February 28, 1953, Cambridge University scientists James D. Watson and Francis H.C. Crick announced that they have determined the double-helix structure of DNA, the molecule containing human genes. The molecular biologists were aided significantly by the work of another DNA researcher, Rosalind Franklin, although she is not included in the announcement, nor did she share the subsequent Nobel Prize award for it.

Though DNA—short for deoxyribonucleic acid—was discovered in 1869, its crucial role in determining genetic inheritance wasn’t demonstrated until 1943. In the early 1950s, Watson and Crick were only two of many scientists working on figuring out the structure of DNA. California chemist Linus Pauling suggested an incorrect model at the beginning of 1953, prompting Watson and Crick to try and beat Pauling at his own game. 

LISTEN NOW: HISTORY This Week Podcast: The DNA Debate

On the morning of February 28, they determined that the structure of DNA was a double-helix polymer, or a spiral of two DNA strands, each containing a long chain of monomer nucleotides, wound around each other. According to their findings, DNA replicated itself by separating into individual strands, each of which became the template for a new double helix. In his best-selling book, The Double Helix (1968), Watson later claimed that Crick announced the discovery by walking into the nearby Eagle Pub and blurting out that “we had found the secret of life.” The truth wasn’t that far off, as Watson and Crick had solved a fundamental mystery of science–how it was possible for genetic instructions to be held inside organisms and passed from generation to generation.

Watson and Crick’s solution was formally announced on April 25, 1953, following its publication in that month’s issue of Nature magazine. The article revolutionized the study of biology and medicine. Among the developments that followed directly from it were pre-natal screening for disease genes; genetically engineered foods; the ability to identify human remains; the rational design of treatments for diseases such as AIDS; and the accurate testing of physical evidence in order to convict or exonerate criminals.

Crick and Watson later had a falling-out over Watson’s book, which Crick felt misrepresented their collaboration and betrayed their friendship. 

A larger controversy arose over the use Watson and Crick made of work done by another DNA researcher, Rosalind Franklin. Colleague Maurice Wilkins showed Watson and Crick Franklin’s X-ray photographic work to Watson just before he and Crick made their famous discovery. The imagery established that the DNA molecule existed in a helical conformation. When Crick and Watson won the Nobel Prize in 1962, they shared it with Wilkins. Franklin, who died in 1958 of ovarian cancer and was thus ineligible for the award, never learned of the role her photos played in the historic scientific breakthrough.

Citation Information

Article Title

Chemical structure of DNA discovered

Author

History.com Editors

Website Name

HISTORY

URL

https://www.history.com/this-day-in-history/watson-and-crick-discover-chemical-structure-of-dna

Access Date

March 22, 2021

Publisher

A&E Television Networks

Last Updated

March 2, 2021

Original Published Date

November 24, 2009TAGSSCIENCEBY HISTORY.COM EDITORS

© 2021 A&E Television Networks, LLC. All Rights Reserved.

Essay: Humans Resist Getting Organized But Feel So Much Better After They Do. It’s like working out.


Today is Red 6 Rhythmic Moon. Can you organize your feelings instead of acting on them?

What most people do is eat or drink alcohol more when they don’t want to deal with organizing their feelings. My “go to” lately are frozen yogurt bars. In the past it was bingey potato chips. Humans are addicted to feelings so avoid them. I believe Huey Lewis sang about being “addicted to love.” He meant the sexy, lusty, emotional kind. He did not mean the real kind.

The Moon has entered Sagittarius which the Virgo Sun forms a square to this afternoon during Blue 6 Storm. This could create some tension unless you know how to ignore pettiness and gossip.

Big minds discuss ideas, mediocre minds discuss events and small minds talk about people.

Eleanor Roosevelt

That sizes up our media in a nutshell. I guess that’s why I’m annoying. All I want to talk about is ideas and it stresses people out. My big idea with this blog is that our DNA holds more information than anyone realizes. It shapes who we are over time and within our families. I’m scoping out facts and research and then adding my intuition to the mix. One would think that would be valuable to a whole lot of people. However, most of them are busy reacting to what everyone else does. Worse, they are following what everyone else does.

The Theme is Red 6 Moon. Analog is White 6 Dog. Guide Power is itself. Antipode is Blue 6 Storm. Hidden Wisdom is Yellow 6 Human. Therefore, Mercury, Pluto opposing, and Earth are strong players astrologically from the UNIVERSAL perspective. They are not strong from the astrological perspective.Mercury mediates Red Moon and White Dog. The good part is that a Mercury-Uranus trine opens us to creative ideas. The 5GForce is Blue 8 Monkey or galactic creativity, playfulness and illusion. It actually comes up as the Gateway in two days. The galactic tone is all about integrity and doing what you say you’re going to do. That creates harmony and a good example for others.

There is definitely a creative restlessness in the astrology and in The larger Matrix. Channeled well, these aspects encourage us to improve but otherwise might lead to over-indulgence, lack of moderation, or exaggeration. We need to be in touch with our feelings so we can moderate our expectations of ourselves and others.

Methionine is the start codon for the mRNA sequence. Tryptophan sometimes functions as a stop codon. This could be a defining day. It could also be a type of test to see if we’re taking control of our vibe. Look at the similarity between White Dog and Yellow Human. Yellow Human just has the extra COOH molecule.

The tryptophan molecule has the presence of the hexagon and the pentagon. This structure indicates that Jupiter and Saturn influenced the cohesion of our DNA in the past. Now that that’s over I wonder if it will be replaced with something else or rehabilitated?

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

The Facts of Evolution Overstep Fate and Destiny


I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.

All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.

On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.

However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.

But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.

Cosmics have the patience of a great tree. We have enduring patience and perseverance.

Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.

Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.

The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.

Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.

Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.

The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.

No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.

MOLECULAR LINE-UP

The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

There are Limitations on an Evolutionary Planet


The reason there are limitations is because of TIME as DNA regulating movement. Time is not just the movement of our planet/planets around our star, The Sun. Our minds are hypnotized with the reality of Time just like the mask wearers are hypnotized by the specter of certain death whether it be from CV2, a hospital respirator, a botched hospital procedure that they submit to or their violent mate. None of that is real in that it doesn’t exist unless the mind of the person CREATES it by obsessively focusing on it all the time as well as the T.V. PROGRAMMING of their minds that they can’t turn off because they’re afraid they’ll miss something, like a message from ON HIGH since whatever is said on TV is altruistic, all-loving God looking out for them. They have to believe that because they are bereft and empty without it. So, I give up helping.

We are on Tone 11 White 11 Wind today and a majority of Americans are still spectrally, chaotically, dissolving themselves in fear, in a puddle, anywhere they find themselves. They are doing it to themselves in their limitation, in their fear, in their unwillingness to think rationally or spiritually. Some however, are waking up. That said, the authorities are tying the hands of business and sending out checks so there is something MUCH bigger going on.

I have a new theory about the people freaking out over a virus and believing they have NO IMMUNE SYSTEM WHATSOEVER to kill a virus even though the facts of the last ONE MILLION years of human existence prove otherwise. They can’t listen. Why not?

I dissolve in order to communicate. Releasing breath I seal the input of spirit with the spectral tone of liberation. I am guided by my own power doubled

The Dreamspell by Jose A.

Because they don’t really believe GOD or SOURCE is IN them. They think it’s a load of B.S. They are cynical 3D materialists who only feel what they can see, touch, hear, feel, and smell. That’s all that’s real to them and they don’t mind a mountain of evidence proving them 100% wrong because they don’t want to do the work to LISTEN and hook up to Spiritual presence in them through mediation and movement. They are scared of that too because they feel guilty for being weak and selfish.

My ex used to always say, “If you make a mistake you are forgiven.” That is true. But if you don’t learn to work at helping yourself you’re doomed. People who care, helper people and light workers are not supposed to help people who won’t help themselves. It’s very dysfunctional and we’re done with dysfunctional. That is chaos and usage. Karma is coming your way and karma is coming people’s way who continue to sit in fear and are so willing to let our entire society shut down just because they’re scared and can’t think straight.

There is a reason this is happening. You either adapt to the new environment and energies or go. I didn’t make this plan. I’m just relaying it on a White Wind gateway because the human species has life to live and we’ve been given a lot of information that is about to come to the forefront so we can really change this planet. Let’s get cracking!

MOLECULAR LINE-UP

The middle one in the pink boxes is phenylalanine and tryptophan on the other side. They are almost the same, as usual; a synchronicity and no doubt key to protein folding.

Glycine is White Wind, Phenylalanine is Red Earth, Glutamic Acid s Yellow Human, and Blue Storm is Tryptophan.

Daily Meditation is KEY right now.


I’m doing no compliance, obedience, or following at all because the edicts and narratives are 100% wrong. Meditation is going to help you feel more confident now because your mind will be focused and informed by SOURCE, not by human society. I have no emotion or values invested in other people’s choices about meditating, wearing a mask, getting a vaccine, or tanking their immune system. It’s not my place to validate or invalidate anyone’s choice. I’m just relaying what I and millions of others are doing.

We are in the midst of Harmonic Convergence. The first one was June 21; Summer Solstice and the Eclipse. The second one was today, 8 hours ago at 1:48am EST, the 3rd one is July 5th. I’m working the energy daily, not just on one of those days, and everything in my life is improving (money, body, mood, projects). If you’re following along or reacting to the supremely negative energy right now that’s a red flag. No matter how negative anyone is around you, if you’re hooked up to Source and working the energy, your life is improving while the others fall away. There may be name-calling, cut-offs, and attempts at control and commands to wear a mask. Nada. We are FREE on this planet, legally and spiritually to direct our own bodies and lives and it’s past time to do it.

The line-up today is Red 2 Stabilizing Skywalker with analog White 2 Stabilizing World-bridger. “The polarizing tone knows that there is a delicate balance in the world that we are always walking a tightrope of wholeness and separation, of integration and release. “-Another World App

The Guide Power is Red 2 Serpent; survival, instinct, and life-force until noon. There is a RESET going on and the human race is polarizing, stabilizing, and waking up for SURVIVAL! It’s totally up to us. Whatever forces we THINK have authority over us know that they DO NOT if we all engage our MINDS, focus our INTENT and HEARTS on what is good and right for the planet and then DO IT and be free. Think about the peon politicians, a handful of crazy people. They have no power against the masses and history has shown it. They will NOT be allowed to use nuclear weapons against us or the Earth. Our helpers have stopped it multiple times and would again. Take your mask off, go about your life, have sex, hug and love your friends, have parties, and use natural remedies to get through these viruses and climate changes. Remember the earth is at a reset point also and we may see some strange new insects or animals, as well as foliage, looking different. Life is ONE.

MOLECULAR LINE-UP

We get to see some key interactions today. The first molecule shows how Red Skywalker (glutamine) and Yellow Star, (Leucine) intimately interact. The second picture show how similar Red Serpent (Serine) is to White World-Bridger (Threonine). W.W. tribe brought more carbon into the mix as humans had to settle here after the Maldek disaster. Red Serpent mediating planet is Maldek and Red Skywalker∞White Worldbridger are mediated by Mars. Mars was Maldeks moon at the time.