Our DNA is Time But Its Source is Timelessness


The lemniscate or Infinity Symbol

Timelessness is one with our DNA.

What animates our human flesh of DNA is timelessness. As you ponder this instead of taking for granted your warm body, breath, mind, thinking, and physical movement, know that what makes you a conscious warm body is eternal. The energy that enlivens you never ends. It is eternal or beyond time. It is one with your FLESH, manifested DNA.

DNA is time but it is also timeless because it’s Source is timelessness.

Even though it’s manifested in time that doesn’t limit its power. You can align anything out of balance. You have the power in your flesh and blood to HEAL YOURSELF. You don’t really need any meds, tech, etc. Just focus your mind INTO your body with intention. It’s like being thirsty and swallowing cold water. Perfect.

Watch “Progressive Couple Thrilled With Latest Mandates” on YouTube


This is a riot…

Artificial Intelligence has been insidious for 1000 years or more gradually hijacking human real intelligence based in DNA. Many people got used to it and it’s run all of our institutions. No more.

I pointed this out and had a Twitter Feed Called Real Intelligence 3 Years Ago Against A.I. It Was Shadow Banned. Skywalker is Prophetic. HUMAN DNA IS REAL INTELLIGENCE!!!!!


TIME TRAVEL During the Philadelphia Experiment. Something Interesting on a Saturday Night.


Al’s journey began in 1943 when he and his brother Duncan jumped off the USS Eldridge during the Philadelphia Experiment. With his brother, they ended up in the hospital in 2137, having experienced severe injuries. They remember waking up in a hospital room. At this time, Al alone traveled in 2749 and spent two years there. El recalls his stay in the future year 2749.

Al saw a very technologically advanced civilization. There were “weightless cities” and cities on earth. The houses in the city were 2,100-2,200 stories high. At that time, people had already surpassed the barriers of gravity and could build some kind of “anti-gravity platforms”. In such houses, these platforms were inserted at certain intervals, and thus the cities were built. Plus, if they wanted the city to float, they could. The city could move from one part of the Earth to another.

Belinsky

Here is the full story.

https://monster-evo.ru/en/belinskijj/filadelfiiskii-eksperiment-al-bilek-uchastnik-filadelfiiskogo-eksperimenta-rasskazal-o-svo-m-putesh/?fbclid=IwAR06CIvE104z_U_Bl3m8NZMMTm6pFri_nvlEnwIaEA6l5KfmljjGj7syUUY

Watch “SSP Alliance Update: RECON – Reptilian ET bases on the Moon, Mars, & Antarctica Pt. 1” on YouTube


Stick with this as you watch. There is an important section on the Maya. There are two groups; the E.T. (who I am in meditation with one woman Alishka) and the Olmec group here on earth.🌎 The Maya are great healers and have worked with me now for 30 years in all of my work and now in my office. I did 10 minutes of Reiki on another patient today and she really felt it.

They are responsible for healing Corey Goode, Yellow 7 Resonant 🌞 Sun after all of his trauma.

Aurora borealis could be visible in wide swaths of continental US, Europe on Saturday because of large solar flare – CNN


The Mayan Tzolkin projected through the sun onto the earth’s Psi Bank creates the aurora borealis.

The same projection IS your DNA. Every cell of our body is an aurora borealis. We just need to acknowledge it and focus it. We don’t need A.I.

https://www.cnn.com/2021/10/29/weather/northern-southern-lights-us-europe-wx-scn/index.html

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


This post is from August 2020.

Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made


Today is June 5, 2024, and I’m posting it again. When are people going to listen? They made a toxic vaccine. I warned people.

I posted this July 23, 2020, a year and a half ago.

For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

abstract technology science concept DNA binary on hi tech blue background
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Dr. Chavez Had A Stroke


Dr. Fernando Castro Chavez

It happened two weeks ago and I didn’t say anything because it’s too f…..g depressing.

He’s alive and rehabbing in TX now. It occurred in his lower limbic brain so they think with time he may be ok.

Dr. Chavez was extremely outspoken and emotional about the virus and the vaccine as well as very knowledgeable because he was looking at it in the lab. I posted on it often and was analyzing the sequence according to the Tzolkin but didn’t finish so I could get my book done. I’m hoping they didn’t force the vaccine on him in the hospital which is even more depressing.

He had lost his job at the NY school because of his positions and feelings (politics) and I have to wonder if this was some kind of c!@dl attack on him because he worked with high-ranking people. His sister is in touch with me.

Dr. Chavez was the only microbiologist familiar with my work and the Tzolkin. He was also complementary and supportive. I was about to ask him (hire him) to edit my book and give comments before I print in paperback. Now what am I going to do? Par for my course in this life. I ALWAYS hit walls but I never give up.

Everything happens for a reason 😌 so what is the synchronicity? I don’t know yet. I may ask a couple biology profs at my alma mater to look at it and watch their eyes glaze over. Oracles? Amino Acids? E.T. ancestors? Oh god. Maybe not. As of November 2022 I have heard nothing back. I figured as much.

Please send good vibes for this info. If I’m on to something, and I’m sure I am, “they” may try to stop me. It’s too empowering and would change the sciences. What does a woman without a Ph.D. think she’s doing? They have no idea.

Maybe it’s about timing. We’ll see.

Peace. Red 13 Cosmic Skywalker, Lisa T.

When We Empower Ourselves and Others, We Evolve Forward By Creating Synchronicity


We are in the Galactic Matrix; Self-Regulate Universal Fire of Integrity; HF15

This is done by taking care of our own bodies and being a good example to others, simply sharing or teaching rather than nagging or prodding. It’s important for people to choose it for themselves rather than you doing it for them. Human nature is to rebel against that.

Since the body IS TIME, we now understand that the balance between a past mindset and a future mindset is what creates synchronicity that we can observe around us in the matrix but especially in our own lives with family and friends. Synchronicity with people and events is like breathing or the change between light and dark. It’s completely natural.

Abraham Lincoln

Synchronicity is apparent and balanced constantly when there is a balance between the CA, civilizational advance strand, and the AC or aboriginal continuity strand of our DNA. In my opinion, our society has gotten far out of balance because of spending too much time dwelling on and rehashing THE PAST instead of creating our own future. Each individual needs to do this. I saw this saying yesterday.

Body Holon

  • Theme is 5Phenylalanine or Red 5 Radiant Earth; Synchronicity
  • Analog is 5Glycine or White 5 Radiant Wind; Spirit
  • Guide Power right now is 5Serine or Red 5 Radiant Serpent; Sex or Life-Force. Same thing.
  • Antipode is 5Isoleucine or Blue 5 Radiant Hand: Accomplishment
  • Hidden Wisdom is 9Valine or Yellow 9 Solar Seed; Flowering
  • 5GForce is 9Alanine or Blue 9 Solar Night; Abundance

Interplanetary Holon

The mediating planet is URANUS which rules Aquarius. The Moon is in Cancer. Mercury and the Moon form aspects to NEPTUNE that increase inspirational communication. This is in synchronicity with the ANALOG; White 5 Radiant Wind.

Uranus-New Images from NASA

Sabian Symbol Astrological Reading

  • Sun in Scorpio-The Stabilising influence of institutions. ? Sun∞Storm
  • Moon in Cancer-Celebration of permitted emotions. Permitted ? Moon∞Dog
  • Mercury in Libra-RETIRING FROM THE STRUGGLE. (Yes. Clear your energy and stop watching it.) Moon∞Dog
  • Venus iin Sag-Loyalty to one’s own way of being (Self-Existent and Radiant) Star∞Monkey
  • Mars in Libra-Having faith that we are part of something bigger. (Yes-A grand Universe whose power is in our bodies) World-Bridger∞Skywalker
  • Jupiter in Aquarius-The discipline of self-Control Seed∞Eagle
  • Saturn in Aquarius-The creative power of admiration Night∞Warrior
  • Uranus in Taurus-Simple Pleasures Wind∞Earth
  • Neptune in Pisces-Training in optimism Dragon∞Mirror
  • Pluto in Capricorn-The convergence of tradition, spirituality, and commerce Sun∞Storm
  • North Node in Gemini-Spiritual blessings
  • South Node in Sagittarius-Power of the unconscious
Sabian Symbol-The Ocean Covered with White Caps

Mystery Radio Waves Coming From Unknown Object in the Galaxy’s Center


“Mystery Radio Waves Coming From Unknown Object in the Galaxy’s Center”

Giving earth Creative Tones tones 14 to 26 to diversify us further? Just an idea.💡

https://www-businessinsider-com.cdn.ampproject.org/v/s/www.businessinsider.com/mystery-radio-waves-unknown-object-milky-way-center-2021-10?amp=&amp_gsa=1&amp_js_v=a6&usqp=mq331AQIKAGwASCAAgM%3D#amp_tf=From%20%251%24s&aoh=16351587754156&csi=0&referrer=https%3A%2F%2Fwww.google.com&ampshare=https%3A%2F%2Fwww.businessinsider.com%2Fmystery-radio-waves-unknown-object-milky-way-center-2021-10

Physics Unfolds Right Before Your Eyes in this Display of Synchronicity


11. 25. 14  by   JAIME TROSPER

From Futurism

In both biological and physical systems, something called synchronicity sometimes surfaces. In the broadest possible terms, it explores the relationship between cause and effect and ‘meaningful coincidence.’ Not to mention, makes a stunning display of physics.

Simply put, synchronicity is a phenomenon in which one or more external things seem to be intrinsically tied together. 

Take an orchestra — when an assortment of separate instruments work together to make music — for example. Despite the fact that each has a separate, distinct sound, they eventually get on the same wavelength.  Of course, there are other examples,  like GPS systems, certain sporting events (like synchronized swimming) and even a human heart beat.

Unlike the other examples, in nature, nothing in particular forces these things to sync up. (Yes it does. The past and future timelines that are the DNA strands)

Oftentimes, it isn’t even intentional, but the pure result of chance (like, say. when you look at a clock and see that the hour/minute are the same as the month/day, 11:11 on 11/11). In the spirit of the seemingly impossible happening, picture one, single metronome (a device that was built to tick at regular intervals, like a wristwatch). It can march to the beat of its own drum perfectly, but staying in sync becomes more difficult when we start adding additional metronomes into the equation.

Two can tango, and 4 can effectively square dance, but how many more metronomes can you throw in before they start doing their own different dance? 

This video demonstrates that, over the course of a minute or two, not ten, or even twenty, but thirty-two metronomes can sync up and remain that way without even the slightest intervention by humans.

WATCH: SYNCHRONIZATION OF THIRTY TWO METRONOMES:

The video’s author explains how it works: Metronomes (or “pendula”), when on table, oscillate with random phases, since that is how they started and they are “uncoupled” (no energy/information flows from one to other so they do not “know” each other.) When they are all together on the cans, notice that the cans themselves oscillate little, providing coupling/information crossover. which forces “synchronization” in periodic systems.

SPACE Wild New Paper Claims Earth May Be Surrounded by a Giant Magnetic Tunnel


Corey Goode posted this article on LinkedIn this morning.

“Who else thinks this sounds a lot like my 20-and-Back testimony from my movie ABOVE MAJESTIC where I described how the Galactic Portal System worked? These electromagnetic filaments ultimately connect to the Cosmic Web. CG:

Wild New Paper Claims Earth May Be Surrounded by a Giant Magnetic Tunnel -“

From sciencealert.com

Left: what the tunnel would look like; right: what the sky does look like. (Image Credit Below)

MICHELLE STARR 15 OCTOBER 2021

Mysterious structures in the sky that have puzzled astronomers for decades might finally have an explanation – and it’s quite something. The North Polar Spur and the Fan Region, on opposite sides of the sky, may be connected by a vast system of magnetized filaments. These form a structure resembling a tunnel that circles the Solar System, and many nearby stars besides.

“If we were to look up in the sky,” said astronomer Jennifer West of the University of Toronto in Canada, “we would see this tunnel-like structure in just about every direction we looked – that is, if we had eyes that could see radio light.”

We’ve known about the two structures for quite some time – since the 1960s, in fact – but they have been difficult to understand. That’s because it’s really hard to work out exactly how far away they are; distances have ranged from hundreds to thousands of light-years away. However, no analysis had ever linked the two structures together.

West and her colleagues were able to show that the two regions, and prominent radio loops in the space between them, could be linked, solving many of the puzzling problems associated with both. Comparison with a real tunnel showing orientation. (Left: Pixabay/wal_172619/J. West; Right: Dominion Radio Astrophysical Observatory/Villa Elisa telescope/ESA/Planck Collaboration/Stellarium/J. West)

“A few years ago, one of our co-authors, Tom Landecker, told me about a paper from 1965, from the early days of radio astronomy. Based on the crude data available at this time, the authors (Mathewson & Milne), speculated that these polarized radio signals could arise from our view of the Local Arm of the galaxy, from inside it,” West explained. “That paper inspired me to develop this idea and tie my model to the vastly better data that our telescopes give us today.”

Using modelling and simulations, the researchers figured out what the radio sky would look like, if the two structures were connected by magnetic filaments, playing with parameters such as distance to determine the best fit. From this, the team was able to determine that the most likely distance for the structures from the Solar System is around 350 light-years, consistent with some of the closer estimates. This includes an estimate for the distance of the North Polar Spur earlier this year based on Gaia data, which found that almost all of the spur is within 500 light-years.

The entire length of the tunnel modeled by West and her team is around 1,000 light-years. Light intensity of the North Polar Spur (top) and Fan Region (bottom). (West et al., arXiv, 2021) This model is in agreement with a wide range of observational properties of the North Polar Spur and Fan Region, including the shape, the polarization of the electromagnetic radiation (that is, how the wave is twisted), and the brightness.

“This is extremely clever work,” said astronomer Bryan Gaensler of the University of Toronto. “When Jennifer first pitched this to me, I thought it was too ‘out-there’ to be a possible explanation. But she was ultimately able to convince me! Now I’m excited to see how the rest of the astronomy community reacts.”

More work is needed to first confirm the findings, and then model the structure in greater detail. But doing so may help to solve an even bigger mystery: the formation and evolution of magnetic fields in galaxies, and how these fields are maintained. It could also, the researchers said, provide context for understanding other magnetic filament structures found around the galaxy. The team is planning to perform more complex modelling; but, they suggest, more sensitive, higher-resolution observations would help reveal hidden details that show how the structure fits into the broader galactic context.

“Magnetic fields don’t exist in isolation. They all must connect to each other. So a next step is to better understand how this local magnetic field connects both to the larger-scale galactic magnetic field, and also to the smaller scale magnetic fields of our Sun and Earth,” West said. “I think it’s just awesome to imagine that these structures are everywhere, whenever we look up into the night sky.” The research is due to appear in The Astrophysical Journal, and is available on arXiv.

Cover image credit:  Dominion Radio Astrophysical Observatory/Villa Elisa telescope/ESA/Planck Collaboration/Stellarium/J. West © ScienceAlert US LLC. All rights reserved

Dr. Malone on the mRNA Vaccine he Created FOR HIGH RISK INDIVIDUALS ONLY.


He has no love for Fauci and they asked him why they did this mandate. He doesn’t know.

Harvard Scientist Defends Natural Human DNA That Has Created Our Immune System-From Brownstone Institute


Harvard Epidemiologist Censored by LinkedIn for Defending Healthcare Jobs

LinkedIn distinguished itself in the social-media market for its focus on professionals. The idea was to develop a digital network designed to advance one’s career. The company makes money from advertising but also through an impressive jobs marketplace. You can offer a job or apply for one. It promised to empower the individual worker – admittedly most white collar positions – with choice of employment. To this end, it has added value to professional life. 

Now it appears to have joined the censorship brigade, targeting probably many venues but the Brownstone Institute in particular. The timing is particularly awkward because of the potentially millions of people who could be fired from their positions in the coming weeks and months for non-compliance with Covid19 mandates.

Brownstone has defended the rights of workers to choose against vaccination and in favor of natural immunity or exposure through normal living.  The take downs of our posts began last week when the venue took down a piece arguing against the politicization of disease. The post was put up and disappeared. This happened to everyone who attempted to post the piece. It was a magic disappearing act, clearly targeting the URL and content.

We thought we found a workaround by posting the link for mobile viewing but LinkedIn’s algorithms figured that one out quickly and took it down too. As with all such cases, the first impulse is to believe that there was something about that piece that the censors found objectionable, perhaps in tone or content. And that piece did have an edge about it. Surely it was just once. It won’t happen again, or so we hoped. 

Now we find a pattern.  The famed Harvard epidemiologist Martin Kulldorff – one of three brave scientists who drafted the Great Barrington Declaration one year ago today – wrote a piece in defense of the nurses at a Harvard hospital who are refusing the vaccination. These nurses and others in the hospital had worked mightily and tirelessly for 21 months with daily exposure to SARS-CoV-2 and had thereby acquired natural immunity which all research has shown to be as good or better than the vaccine. They do not need it. It is unscientific to the point of absurdity for these immunity mandates not to consider natural immunity, about which humanity has known for 2.5 millennia. 

“Hospitals are firing nurses and other staff with superior natural immunity while retaining those with weaker vaccine-induced immunity,” wrote Kulldorff. “By doing so, they are betraying their patients, increasing their risk for hospital-acquired infections. If university hospitals cannot get the medical evidence right on the basic science of immunity, how can we trust them with any other aspects of our health?” 

LinkedIn at first accepted the article on its platform. It unfurled the post with image and excerpt. It achieved a very high reach with many likes and shares. This makes sense because so many people on this platform are either losing their own jobs or losing colleagues in every profession. Kulldorff was bravely coming to their defense. 

Within the first hour of posting, the unfurled posts started disappearing. Kulldorff’s own posting on his LinkedIn page disappeared. So did the Brownstone post. Along with it, all shares were made to disappear too. This article – by one of the world’s leading scientists at one of the world’s most prestigious universities that defended workers and their jobs – was being torn down by a platform designed to assist people in their career advancement.  As the hours went by, the hit on this piece in particular lightened up just a bit. The venue would allow the article link to appear but refused still to unfurl the post. This means that readers are unable to see the title, the image, or read a summary.

We are not privy to their algorithmic experience but it seems likely that doing this to a link would dramatically reduce its readership, simply because outside links routinely include all that information.  The previously unfurled posts were all deleted along with all likes, shares, and comments. The new links remain but with a very low level of engagement.  Before releasing this information, we waited a full 24 hours to make sure that this was not some technical fluke. It appears not to be. It appears that LinkedIn has decided deliberately to throttle a job-related post by a high-level and world-famous scientist that addressed an issue of intense interest to all users of the platform. 

LinkedIn has for the most part been on the sidelines of the great censorship battles of our time. (No it hasn’t-Lisa). With this move, it seems to have engaged it on the side of the censors. They have given no explanation, provided no appeals path, or even posted a link to the terms of service that might have been crossed. They simply blackballed the post without any further commentary.  In taking this action, LinkedIn has denied crucial information to millions of professionals who deserve to hear a different opinion about the mass firings taking place in light of the vaccine mandates that contradict the known science and freedom in the marketplace for jobs. The move is a direct hit against workers and their career aspirations.  It’s a good bet that this article will be censored too.     Copyright © 2021 Brownstone Institute, All rights reserved. You are receiving this email because you opted in via our website.

Our mailing address is: Brownstone Institute2028 E Ben White Blvd # 240-3088Austin, TX 78741-6966Add us to your address book Want to change how you receive these emails? You can update your preferences or unsubscribe from this list.

Interplanetary Holon; Enceladus


One of Saturn’s Moons; A water based one.

Note at 5:50 where he talks about amino acids present on the moon. I mentioned in a previous post that they are present on all of the planets and moons.

Saturn mediates Yellow Warrior ∞ Blue Night or Histidine and Alanine

mRNA vaccine Causing Myocarditis…Unreported.


Another simple way you can control your own DNA and save your life is to NEVER take anything into your body that is based in man-made mRNA. OMG. If people only knew basic genetics…but most kids aren’t educated about their bodies in school as they should be.

Most viruses are evolving RNA, naturally. They cannot be controlled OUTSIDE of the body. Viruses are handled fairly easily once INSIDE the body by our fantastic immune system. I, and MILLIONS of physicians have been saying this since March 2020. My family and many friends have disowned me because of it. I no longer care. I have a reason to live. Maybe they don’t.

UFO Worldview Control, a Vast No-wing Conspiracy


Here’s my favorite UFO historian, Richard Dolan, recounting one of the most well-documented UFO military encounters of all time, the 1976 Tehran UFO incident. Toward the end of the video, things get interesting as Dolan shows us what the debunkers at Wikipedia have to say about this event. True to form, Wikipedia struggles to maintain […]

UFO Worldview Control, a Vast No-wing Conspiracy