DISCLOSURE info.


Two years hence, 1/2/23, they’ve changed their tune! These folks are NOT encouraging contact because of what they’ve learned or for some other reason.

The DNA Double Helix as Time. Go to 15:35 on the video.


He just posted this on Twitter. I’ve already asked him how he knows this. Did he see it? Did he dream it? Did an E.T. tell him? Is it in The Law of One? Did the Blue Avians tell him?

Start at minute 15:45 and listen to him. I just hit the jackpot. What he describes is EXACTLY what I see when I’m analyzing the Tzolkin with the Amino Acid DNA molecules. I’ve written down what he said and will QUOTE him in my book. But I’d like to know the Source.

Tweet from Laura Ingraham (@IngrahamAngle)


Laura Ingraham (@IngrahamAngle) Tweeted: President needs to say THIS in every speech. We know @CNN and @MSNBC will NOT tell you this COVID truth.

These are the covid survival rates. Must see.

Tweet from Edward Snowden (@Snowden)


Edward Snowden (@Snowden) Tweeted: Amazon announces Spyware-as-a-Service: https://t.co/6hkzsHjxh9 https://twitter.com/Snowden/status/1305883597262520325?s=20

A Cool 2-minute video giving you the gist of How the Tzolkin Works.


https://mayaarchaeologist.co.uk/2016/12/31/maya-calendar-system/

Exopolitics.org


I know this will raise many questions but I’ve been following both of these gentleman for about a year and highly recommend. Follow the website. You won’t get this insider info. anywhere else. Lisa T.

Interview with Corey Goode on UFO Disclosure War, QAnon, Military Arrests & Dark Fleets

Essay: Humans Resist Getting Organized But Feel So Much Better After They Do. It’s like working out.


Today is Red 6 Rhythmic Moon. Can you organize your feelings instead of acting on them?

What most people do is eat or drink alcohol more when they don’t want to deal with organizing their feelings. My “go to” lately are frozen yogurt bars. In the past it was bingey potato chips. Humans are addicted to feelings so avoid them. I believe Huey Lewis sang about being “addicted to love.” He meant the sexy, lusty, emotional kind. He did not mean the real kind.

The Moon has entered Sagittarius which the Virgo Sun forms a square to this afternoon during Blue 6 Storm. This could create some tension unless you know how to ignore pettiness and gossip.

Big minds discuss ideas, mediocre minds discuss events and small minds talk about people.

Eleanor Roosevelt

That sizes up our media in a nutshell. I guess that’s why I’m annoying. All I want to talk about is ideas and it stresses people out. My big idea with this blog is that our DNA holds more information than anyone realizes. It shapes who we are over time and within our families. I’m scoping out facts and research and then adding my intuition to the mix. One would think that would be valuable to a whole lot of people. However, most of them are busy reacting to what everyone else does. Worse, they are following what everyone else does.

The Theme is Red 6 Moon. Analog is White 6 Dog. Guide Power is itself. Antipode is Blue 6 Storm. Hidden Wisdom is Yellow 6 Human. Therefore, Mercury, Pluto opposing, and Earth are strong players astrologically from the UNIVERSAL perspective. They are not strong from the astrological perspective.Mercury mediates Red Moon and White Dog. The good part is that a Mercury-Uranus trine opens us to creative ideas. The 5GForce is Blue 8 Monkey or galactic creativity, playfulness and illusion. It actually comes up as the Gateway in two days. The galactic tone is all about integrity and doing what you say you’re going to do. That creates harmony and a good example for others.

There is definitely a creative restlessness in the astrology and in The larger Matrix. Channeled well, these aspects encourage us to improve but otherwise might lead to over-indulgence, lack of moderation, or exaggeration. We need to be in touch with our feelings so we can moderate our expectations of ourselves and others.

Methionine is the start codon for the mRNA sequence. Tryptophan sometimes functions as a stop codon. This could be a defining day. It could also be a type of test to see if we’re taking control of our vibe. Look at the similarity between White Dog and Yellow Human. Yellow Human just has the extra COOH molecule.

The tryptophan molecule has the presence of the hexagon and the pentagon. This structure indicates that Jupiter and Saturn influenced the cohesion of our DNA in the past. Now that that’s over I wonder if it will be replaced with something else or rehabilitated?

Recently Retired USAF General Makes Eyebrow Raising Claims of Advanced Space Technology


The U.S. currently possesses revolutionary technologies that could render current aerospace capabilities obsolete: “[M]ost Americans and most members of Congress have not had time to really look deeply at what is going on here. … [T]echnology can be built today (that can)… deliver any human being from any place on planet Earth to any other place in less than an hour.”

Article by Brett Tingely                         December 11, 2019                         (thedrive.com)

• US Air Force Lieutenant General Steven L. Kwast (pictured above) served as Commander of the 47th Operations Group at Laughlin Air Force Base and the 4th Fighter Wing at Seymour Johnson Air Force Base, and had support within the Armed Forces to be appointed as the Commander of the Pentagon’s Space Force. Instead, Kwast retired this past September. On November 20, 2019, Kwast gave a lecture titled “The Urgent Need for a U.S. Space Force” at Hillsdale College in Washington, D.C.

• In his talk, Kwast claimed that China is already building a “Navy in space” complete with the space-based equivalents of “battleships and destroyers”, and that the US is not keeping up. We know that China has been rapidly expanding its presence in space in recent years, placing a lander on the Moon last year as a possible first step toward a permanent Moon base. China has also been developing “mothership” aircraft from which to launch ‘space planes’ and other payloads into space. China has been investing heavily in manned and unmanned space technologies that rivals, and in some ways, exceeds our own. Kwast believes we need a Space Force in order to counter Chinese advances and win the competition over the economy of the future and, as an extension, the political values for the future.

• Kwast says the “the power of space will change world power forever” and that it’s up to the United States military to leverage that power. The nature of the power of a competitive advantage is “you either have it and your values rule or you do not have it and you must submit. We see that play out again and again in history and it’s playing out now,” Kwast argues. “[China] will pass us in the next few years if we do not do something. They will win this race and then they will put roadblocks up to space.”

• Around the 12:00 mark in the speech (see video below), Kwast makes the somewhat bizarre claim that

The U.S. currently possesses revolutionary technologies that could render current aerospace capabilities obsolete: “[M]ost Americans and most members of Congress have not had time to really look deeply at what is going on here. … [T]echnology can be built today (that can)… deliver any human being from any place on planet Earth to any other place in less than an hour.”

• Other military leaders have made curious comments lately alluding that we could be on the precipice of a great leap in transportation technology. There are many within the U.S. military and analyst community who feel a great need to boost investment in American space technologies and the U.S. military’s presence in space. That vision is taking root across the Defense Department.

• Kwast has published several op-eds in recent years pushing for the U.S. military to take on a greater role in space in order to ensure American economic dominance and what he sees as the continued proliferation of American values. Some have said that Kwast was blacklisted and prematurely relieved of his duties after speaking out on space-related issues in violation of a service-wide gag order. Kwast declined to comment.

• Is all this setting the stage for a new space race that will benefit mankind by furthering scientific and technological development, or is it ushering in the conditions for the first great space war?

Recently retired U.S. Air Force Lieutenant General Steven L. Kwast gave a lecture last month that seems to further signal that the next major battlefield will be outer space. While military leadership rattling the space sabers is nothing new, Kwast’s lecture included comments that heavily hint at the possibility that the United States military and its industry partners may have already developed next-generation technologies that have the potential to drastically change the aerospace field, and human civilization, forever. Is this mere posturing or could we actually be on the verge of making science fiction a reality?

Who Is Steven Kwast?

According to his official USAF biography, Lt. Gen. Kwast graduated from the United States Air Force Academy with a degree in astronautical engineering, and also holds a master’s degree in public policy from Harvard’s Kennedy School of Government. Kwast previously served as Commander of the 47th Operations Group at Laughlin Air Force Base and the 4th Fighter Wing at Seymour Johnson AFB. Kwast boasts more than 3,300 flight hours in the F-15E, T-6, T-37, and T-38 and over 650 combat hours.

Lt. Gen. Kwast most recently served as Commander of the Air Education and Training Command (AETC) at Joint Base San Antonio (JBSA), but retired in August. According to some reports, Kwast was prematurely relieved of his duties at JBSA and blacklisted for promotion after speaking out on space-related issues despite a service-wide gag order. Kwast declined to comment on the reports and retired on September 1, 2019.

Despite the controversy surrounding his removal from his post at AETC, some defense analysts and Lt. Gen. Kwast’s own supporters within the Armed Forces were suggesting prior to his retirement that he should be appointed as Commander of the Pentagon’s budding Space Force. Kwast has published several op-eds in recent years pushing for the U.S. military to take on a greater role in space in order to ensure American economic dominance and what he sees as the continued proliferation of American values.

Gaining The High Ground In Space

Kwast delivered a lecture at Hillsdale College in Washington, D.C. on November 20, 2019, titled “The Urgent Need for a U.S. Space Force.” Kwast’s wide-ranging speech described the power of new technologies to revolutionize humankind, referencing the competitive advantage the discovery of fire offered to early humans and the strategic value that nuclear weapons offered 20th-century superpowers. When it comes to current revolutionary technologies, Kwast says the “the power of space will change world power forever” and that it’s up to the United States military to leverage that power: “As a historian, reflecting on the fact that throughout the history of mankind… technology has always changed world power. But the story of rejecting the new and holding and clinging to the paradigms of the past is why no civilization has ever lasted forever, and values are trumped by other values when another civilization figures out a way of finding a competitive advantage. The nature of power, you either have it and your values rule or you do not have it and you must submit. We see that play out again and again in history and it’s playing out now.”

As has been common as of late, Lt. Gen Kwast cites rapidly growing Chinese military and technological advances as the reason why the United States must invest heavily in new space-based technologies. “We can say today we are dominant in space but the trend lines are what you have to look at and they will pass us in the next few years if we do not do something. They will win this race and then they will put roadblocks up to space,” Kwast argues, “because once you get the high ground, that strategic high ground, it’s curtains for anybody trying to get to that high ground behind them.”

1:06:24 video of Steven Kwast on the Need for Space Force (‘Hillsdale College’ YouTube)

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

The Facts of Evolution Overstep Fate and Destiny


I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.

All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.

On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.

However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.

But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.

Cosmics have the patience of a great tree. We have enduring patience and perseverance.

Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.

Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.

The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.

Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.

Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.

The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.

No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.

MOLECULAR LINE-UP

The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Balancing Equality on Earth Calls for Organized Thinking.


Are you able to track your own thoughts and feelings these days? It’s essential that you have organized thinking to make decisions that are safe and to have a healthy body as our society and media are turned upside down with lies and manipulations.  It’s never been much different than that but now it’s very blatant.

The world and the media around us are run by chaotic, addicted, psychopathic, greedy people who we have allowed to get into power. Why? Humans have a weak point that could easily be our downfall and that is believing what we WANT to believe about the outside world and others and not organizing our observations and thoughts to add it up to the truth. Mammals like to be comfy and domestic. We like to clean up our nest, mate, have babies, nurse them, feed them, work and cook. Most people want others to like them although the number is growing that don’t care. We can see that behavior all over the world in every culture and in the animal world. Anything that challenges that comfy mandate we have learned to take with us into DENIAL. That is especially the case if we had a physically or emotionally abusive childhood. The denial, we feel, helps us survive. I remember a client asking me, “Don’t you think it would be easier if I confront my parent about the abuse after we die and I see them on the other side?” This woman is a lovely spiritual person and this was her thinking. She wanted to remain in denial to not deal with something uncomfortable even though the truth would be revealed. If enough of the population does this societies turn into dictatorships with the population very easy to control because they’ve already been willing to be the emotionally walking dead. The answer is NO! don’t wait. Life is to be lived with faith and passion, failure and success. Grab the TRUTH With gusto and be your best self.

The reason we make this mistake is because we are co-creators with tremendous powers of soul, feeling, passion, and art. Meaning we instinctively know that whatever we personally put our minds and bodies to with regard to OUR OWN lives, it changes and manifests what we want. We’re taught that as children by saving our allowance and then buying something and learning how to ride a bike. We gain freedom of movement. People learn at different rates and with different levels of focus but from the time we are babies we learn that by executing certain behaviors we can get what we want. If we didn’t, we’d never get up on two feet and walk in order to go after it.

However, when it comes to OTHERS, that social piece is a big hang-up for humans. The smartest humans also learn from a young age to get what they want and how to manipulate others emotionally and mentally to get it. Those are the young politicians. They don’t mind lying at all and rationalize it big time. They learn to tell people what they want to hear and are rewarded when they get the response, “Now THAT’s what I wanted to hear.” They raise money and proceed into office rhetorically telling people what they want to hear, not the truth. They are opportunists on the backs of public indolence and then we blame them for being what we wanted them to be. THAT IS HAPPENING NOW on a much wider scale with health, our bodies, and politics. Everything in the media is lies.

Others are not the same as us, yet as young children we are essentially self-focused and see them as mirrors. They are not mirrors. It’s just the mirror neurons of the brain functioning to help us fit in and socialize our brain. What separates people socially are their VALUES which come from a conscience. Our families can only achieve so much in that area. The larger culture steps in affecting our own proclivities and we walk the line of loving others with healthy boundaries or using others with no boundaries.

That’s where SAFE behavior and observation and higher thinking comes in. Today it is seen as TONE 6 whose attributes are balancing equality with organization. There is little if any equal sharing of power on earth whether it be between genders or cultures (races is a misnomer). That’s because the levels of intelligence between humans has a HUGE DIVIDE. Most of the population can only organize their thoughts to the level of a fifth grader and the handful that are doing us in are evil geniuses. This is not a good combination and that is where we find ourselves today.

The Moon is in Gemini and Mercury is the mediating planet for White Dog∞Red Moon so as usual, that is an exact synchronicity with astrology.

Our theme today is White 6 Dog; Love, loyalty and heart. White dog is a strong leader, a guardian, a companion, consistent, faithful, a team player and a joiner. This is a nice change of pace and there are many people like this. It’s not necessarily safe for them to be on the street, but yes, they exist.

The Analog is Red 6 Moon; purification, flow and universal water. I blogged on Red Moon yesterday. Knowing how you feel helps you follow the road signs.

The Antipode is Yellow 6 Sun; enlighten, life, and Universal fire. This is a very spiritual archetype and White Dog is not terribly spiritual but more natural and simple. The Spiritual movement and habits can be challenging for them where in their Dog world, making a meal for someone they care for is as spiritual as they get.

The Hidden Wisdom is Blue 8 Monkey or Galactic play, illusion, and magic. This O.P. gives this kin great physical prowess to the point of being an athlete.  It is artistic with the body, spontaneous, extraordinary and a co-creator of higher physical life.

MOLECULAR LINE-UP

Methionine and the Stop Codon are the Start and Stop codon for the mRNA sequence. That is Yellow Sun and Blue Monkey

Bring Light Into the Body to Survive the Mental Darkness of People Obeying Indolence


DRINK LOTS OF WATER-GOOD WATER!

The tetrahedron is the 4 sided geometrical shape we know as a pyramid. It has one unified point in the center and 5 vertices. Very synchronistically, a WATER molecule is a Tetrahedron. When you drink water you’re drinking microscopic pyramids. Every one of our amino acid proteins that make up every single cell of DNA in our bodies has hydrogen and the Tzolkin Harmonic regulates their movement as time which is DNA. It’s one of the main 5 molecules that compose all life. Hydrogen is the main ingredient in water. Hydrogen is literally called the WATER GENE. It’s the main gene that makes up our genes!

The Pyramid is a tetrahedron with 4 sides and 5 vertices

We know the origin of oxygen on the planet was the first algae that grew here but what is the origin of water? It is our ancient ancestors, the Life Carriers. They have the hydrogen gene and if the atmosphere is ready to grow hydrogen they bring it to the planet. Like most of our amino acids, they found hydrogen IN THE STARS. Stars are made of very hot gas. This gas is mostly hydrogen and helium, which are the two lightest elements. Stars shine by burning hydrogen into helium in their cores, and later in their lives create heavier elements.

TODAY IS Yellow 4 Star so it’s very synchronistic that I found this. From planet to planet, pyramids can be found in our local system. They seem to be structures that are a type of LAB to ground life force on a planet; life we all share. Maybe they are water labs. I haven’t read up on the pyramids yet but the Egyptians were partial to pyramids as well as the Maya and they were from our beloved Pleiadean star system which is closely aligned with VENUS, our mediating planet today.

The 5GForce is Yellow 10 Human which lends credence to the idea that bringing water to a planet from the hydrogen made from stars helps humans evolve.

“I perfect in order to influence. Producing wisdom I seal the process of free will with the planetary tone of manifestation. I am guided by the power of universal fire. I am a galactic activation portal. Enter me.“-The Dreamspell

The Planet Venus mediates Yellow Star and Blue Monkey; leucine and  asparagine.

https://www.resonancescience.org/blog/Tetrahedral-geometry-of-water-found-to-account-for-its-remarkable-properties?fbclid=IwAR2IMPinYan1YOFpFvzWtS72fnu7Y2HgvfvoWOjTN1so8EbU7ewMJF-FzJ0

MOLECULAR LINEUP

  • Theme is Yellow Star-Leucine
  • Analog is Blue Monkey-Asparagine
  • Guide Power is Yellow Seed-Valine
  • Antipode is White Mirror-Tyrosine
  • Hidden Wisdom is Red Skywalker-Glutamine