Check this out at Amazon by Judy Mikovits
This book is unbelievable. I recommend. Pretty riveting. She’s just a lab rat! That seems to be where the action is these days.
Synchronicity is the Source of Consciousness

I read this last year. Great book. Great citations. She is #1 on Amazon in her category. The story she tells of stalking and danger is unreal. Sheโs just a microbiologist, but these days, like Dr. Chavez, itโs a dangerous time. Anyone who was outspoken was in danger.
Judy is an Aries ruled by Mars in synchronicity with being Red 4 Self-Existing Skywalker. Aries women and Skywalker are being vilified right now. Nothing new when you correctly tell the truth, are brave, outspoken, have integrity and are female. All of that is taboo in our c4!@l run societyโฆfor now.
Boycott Rolling Stone rag. They trashed her. They are trash.
Plague of Corruption: Restoring Faith in the Promise of Science (Childrenโs Health Defense)
https://www.amazon.com/dp/1510766588/ref=cm_sw_r_apan_glt_fabc_PFJHJD19W9RN4F64962E
Brownstone Institute
Issue; truth and empowerment for humanity
Remember that earlier this year, there was a concerted attempt on the part of major media and platforms to pretend like lockdowns and vaccine mandates (and medical segregation) never happened.
What about all this carnage we see around us?
The inflation? Thatโs Putin, OPEC, and gas stations.
Learning loss? Oh, one expects that in a pandemic.
Lost workers? Well, itโs just demographics.
Excess deaths not related to Covid? Probably drugs or something.
Crime? Itโs a myth.
Shattered communities? Hey, it happens.
Recession and impending depression? Just part of a cycle.
Whatever is wrong with this country, it has nothing to do with the late unpleasantness. That was all necessary for health, so quit talking about it. The lockdowns didnโt happen or, if they did happen, it was necessary to protect lives. In any case, letโs please just move on.
Whatever you do, donโt connect the dots.
Sadly, too many people wanted to play along with this major effort to sweep everything under the rug. Forget the millions displaced from their jobs. Forget the kids with delayed speech. Forget the missed cancer treatments and other medical diagnostics. What happened had to happen and these are new times.
Why have so many willing to push the suppression of truth? Simply because so many people were involved in the disaster of lockdowns and jab mandates. They either supported them at the time or said nothing against them. Now they donโt want to talk about it.
At Brownstone Institute, weโve made it our mission to connect the dots. We do it every day with the best analysis, research, and commentary. Weโve made all these subjects impossible to ignore. Our thinking is that we have to get this history right, and understand all the cause-and-effect relationships, or we risk repeating the whole calamity under another excuse.
More than anything else, if we are to re-establish and re-prioritize freedom as a first principle, we absolutely must come to terms with what happened and why. We must make the connections between todayโs sufferings โ they take so many forms โ and the egregious policy responses that began only 31 months ago.
Too many people, writers, intellectuals, journalists, and politicians want to forget it all. This is how they can avoid accountability and then do it again when they deem it necessary. As the shampoo instructions say, rinse and repeat.
We simply cannot allow that to happen. Brownstone has emerged as a leading voice to provide the counterbalance. With fully 21 channels of communication, and millions of readers, and reprints in every major language, and venues all over the world where our content runs, and dedicated people who share Brownstone material all day, every day, we have made a huge difference.
That these issues have emerged with major importance in American public life, and also the world over, doesnโt just happen. It is a consequence of the influence institutions like Brownstone have over the public mind. The ideas must get out there, even when major platforms are working daily to suppress them.
Another crucial service that Brownstone provides in these diasporic times: this institution has provided sanctuary for writers, researchers, speakers, and scientists to do their work and get their message out. Our recently started Fellows program has been a godsend, for which we thank our donors.
In fact, Brownstone would not exist at all, much less have the influence it has without generous donors. As we approach the holiday season in these critical times in history, can you please remember the work we do and give with your most generous commitments? So many of you already have and the difference you have made is legion.
We run on a shoestring budget and so every dime counts. Times are hard for everyone but unless the right ideas penetrate the conspiracy of silence, the times will only get harder. We cannot guarantee success but we know that doing nothing will guarantee failure.
Please consider supporting Brownstone. If you are already a donor, thank you ever so much. Please continue! If you have never given, please consider that today and in the coming months.
Our donation form is here. Every effort is greatly appreciated.
Best to you and yours in this holiday season! Copyright ยฉ 2022 Brownstone Institute, All rights reserved.
You are receiving this email because you opted in via our website.
Our mailing address is:
Brownstone Institute
2028 E Ben White Blvd # 240-3088
Austin, TX 78741-6966
Want to change how you receive these emails?
You can update your preferences or unsubscribe from this list.
The White Coats Have Given Over Their Healing Power to The State
The article
The bill would put physicians at risk of losing their licenses and being charged with unprofessional conduct for asking questions about the COVID-19 vaccine and recommending alternative treatments.
Since when is the healing power of the light body governed by “licenses” from the state and their uneducated opinion on a healers conduct when they don’t know the first thing about it?
They are politicians. They are the lowest life form on the planet and at every turn show their obecense to shadow, money, illusion, abuse of power and A.I. Since when do they have a relationship with the Universe or believe in any of it?
They believe in USING the human body, not helping it and this is where the white coat alignment with state and the black market health insurance industry, because of THEIR OWN GREED, has hijacked the human mind and body.
Do the angels really compromise with the devil? Can A.I. really co exist with nature? We all keep compromising to see if they save their own souls before they destroy ours. Why?
The New Parasitic Leviathan โ Brownstone Institute
Stop the Shots. Save Our DNA
Brownstone Institute is In Twitter Jail Over Facts on Masking
| The day after the CDC decided to declare a truce in the war on Covid, the twenty-somethings running Twitter still havenโt gotten the message. They are on the warpath at the behest of the government. For the first time, Twitter took after Brownstone Institute for an article by a scientist. In this remarkable piece, Carla Peeters explains that most of the symptoms of long Covid can be traced to poisoning from masks themselves. The article is technical but compellingโฆand Twitter has decided that it should not be seen. Itโs bizarre because Brownstone has probably run 40 articles on the topic, including the definitive list of academic studies cited the world over. So it goes, but from the beginning, we knew this would be a threat. Weโve already decentralized to build a presence on every other major platform. Weโve also unplugged from the big three as much as possible. Weโve even eschewed Googleโs freebies as a way of protecting your privacy. One war seems to end just as so many others have begun. We always knew that this was fundamentally about the Bill of Rights. Some people donโt like it. Itโs as simple as that. Thank you as always for supporting our work. Here is some content from this week. Dr. Birxโs Fake Science Revealed in Her Own Words BY DEBBIE LERMAN. In her โexcruciating storyโ of the pandemic, The Silent Spread, Deborah Birx does not even try to make coherent scientific or public health policy arguments in favor of the Chinese-style totalitarian measures she advocated. Instead, she provides nonsensical, self-contradictory assertions โ some downright false and others long disproven in the scientific literature.CDC Quietly Ends Differentiation on Covid Vaccination Status BY MICHAEL SENGER. CDCโs COVID-19 prevention recommendations no longer differentiate based on a personโs vaccination statusHow Masking Contributes to Long Covid BY CARLA PEETERS. A lingering disorder that can last for months or years is affecting an increasing proportion of the workforce. The symptoms that contribute to Long Covid could be a result of pandemic measures and masking in particular. Increased exposure to microplastics, nanoparticles, chemicals in masks, and nasopharyngeal tests parallel many of the symptoms that define Long Covid. Why I Signed the Great Barrington Declaration BY DONALD BOUDREAUX. The Declaration merely reminded humanity of what was until early 2020 the consensus among public-health officials, including those at the World Health Organization, on the best means of dealing with respiratory pandemics. All the GBD did, really, was to advise that long-standing consensus be regained and followed. The Brutalization of Compassion BY DAVID MCGROGAN. During the Covid era, we see the same schema writ large in the responses taken by governments across the globe. For the first time in human history, the availability of mass testing allowed us to convince ourselves that we could measure the health of the population, holistically, in real-time, and generate precise statistics permitting us to do so โ right down to the last โcaseโ or โdeathโ. Did Lockdowns Turn Americans Into Lazy Bums? BY JEFFREY A. TUCKER. If governments say that the work ethic amounts to nothing but pathogenic spread, and we can all contribute more by staying home and doing less, itโs hard to go back. It wrecked a generation. We are paying the price now. The Disastrous High-Tech War on a Pathogen BY W. AARON VANDIVER. If we carefully analyze each aspect of the โworld warโ on Covid-19, we can see how each tactic and high-tech โweaponโ has harmed human health, destabilized civil society, and possibly disrupted the ecological balance between the human population and the virus, while enriching private interests and empowering financially captured government regulators. |
Protected: Genome sequence of COVID in a cat nearly identical to viral sequences found in people-Ed Level Advanced
Genome sequence of COVID in a cat nearly identical to viral sequences found in people
A matching genome is fairly easy to find on earth throughout all animal and plant species because we’re all part of the web of life, related to one another, including the E.T. Also, humans would not exist without the direct contribution of reptiles and birds in the genome which came from E.T. Mammals evolved from them. And most of the plants on the planet were here before we were. Ferns are an example. They are ancient. There used to be huge fern forests on Earth.
Scientists know that DNA variance among even potatoes and people is slim. But potatoes aren’t sentient, that we know of, (potato smarts?) but we are. So what is creating the difference between species if not DNA? A: Evolving tRNA (transfer RNA) that is dynamic due to free will and changes daily according to the oracles that I cite on this blog.
When I note which amino acid tRNA molecules are moving that day it’s the first time they are moving that way in the current time. They move the way they do every 260 days but because we are changing due to our own choices, (Yellow Human free will), the tRNA which turns into DNA in the nucleus is never the same. Thus our kids are impossible to fathom for us parents. They incarnate in groups with agreed-upon agendas. That much I see in generational groups and the astrologers see it also.
A person born on White 13 Wind in 2022 is not the same as a person born in 2019 as White 13 Wind. The Oracle takes care of sprocketing the 365-day solar year with the 260-day galactic spin. The birthday of the person in 2019 is different than the one in 2022, thus their interplanetary astrological line-up is different, and their personality is different. That’s 4D. Things do level out and start matching up in your Mayan Oracle themeplex because we’re dealing with the upper densities of existence, past DNA with the Oracle.
Phys.org
Since being identified in people in 2019, SARS-CoV-2 has gone on to infect a wide range of animal species, wild and domestic. Concerns abound that these species jumps could lead to novel mutations and even harmful new variants.
In a new report, researchers from the University of Pennsylvania’s School of Veterinary Medicine and Perelman School of Medicine found that, for at least one example of apparent interspecies transmission, this crossing the species boundary did not cause the virus to gain a significant number of mutations.
Writing in the journal Viruses, the scientists identified a domestic house cat, treated at Penn Vet’s Ryan Hospital, that was infected with the delta variant of SARS-CoV-2 subsequent to exposure from its owner. The full genome sequence of the virus was a close match to viral sequences circulating in people in the Philadelphia region at the time.
“SARS-CoV-2 has a really incredibly wide host range,” says Elizabeth Lennon, senior author on the work, a veterinarian, and assistant professor at Penn Vet. “What this means to me is that, as SARS-CoV-2 continues to be prevalent in the human population, we need to watch what’s happening in other animal species as well.”
The find is the first published example of the delta variant occurring in a domestic cat in the United States. Notably, the cat’s infection was only identified by testing its fecal matter. A nasal swab did not result in a positive test.
“This did highlight the importance of sampling at multiple body sites,” says Lennon. “We wouldn’t have detected this if we had just done a nasal swab.”
Lennon and colleagues have been sampling dogs and cats for SARS-CoV-2 since early in the pandemic. This particular pet cat, an 11-year-old female, was brought to Ryan Hospital in September with gastrointestinal symptoms. It had been exposed to an owner who had COVID-19โthough that owner had been isolated from the cat for 11 days prior to its hospitalization, another household member doing the cat care in the interim.
Working through the Penn Center for Research on Coronaviruses and Other Emerging Pathogens and Perelman School of Medicine microbiologist Frederic Bushman’s laboratory, the team obtained a whole-genome sequence of the cat’s virus.
Sequencing revealed the delta variant, more specifically, the AY.3 lineage. The researchers did not have a sample from the infected owner. Comparing the sequence to the database kept by the Bushman laboratory, however, the cat’s virus was nothing out of the ordinary in terms of the sequences of SARS-CoV-2 circulating in the Delaware Valley region at the time.
“When we looked at a random sampling of human sequences from our geographic area, there wasn’t anything dramatically different about our cat’s sample,” Lennon says. “So, our takeaway was that the cat was not infected by a virus that was somehow highly different.”
Not all variants of SARS-CoV-2 have been equally able to infect a wide range of hosts. For example, the original Wuhan strain could not naturally infect mice; later variants gained that ability. Scientists began seeing infections in cats and dogs from the early days of the pandemic, presumably infected through close contact with their owners.
“The main takeaway here is that as different variants of SARS-CoV-2 emerge, they seem to be retaining the ability to infect a wide range of species,” Lennon says.
While this particular case does not raise alarms for the virus acquiring significant numbers of mutations as it moved between species, Lennon and colleagues, including Bushman and Susan Weiss of Penn’s medical school, hope to continue studying other examples to see how SARS-CoV-2 evolves. Penn Vet’s Institute for Infectious and Zoonotic Disease will facilitate this look at human-animal interactions when it comes to pathogen transmission.
“We know that the SARS-CoV-2 is undergoing changes as it passes between to become more and more transmissible over time,” says Lennon. “We saw that with the omicron variant. It’s host-adapting to people. We also want to know, when other animal species get infected, does the virus start to adapt to those species? And for those viruses that may adapt to a different species, do they still infect humans?”
Explore further
SARS-CoV-2 is moving between humans and wildlife around the US
Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made
Today is June 5, 2024, and I’m posting it again. When are people going to listen? They made a toxic vaccine. I warned people.
I posted this July 23, 2020, a year and a half ago.
For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
9 hours ago
Whatever They Make and Market is Either Culling or a Placebo. It’s Not Medicine.
Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.
As you skim, please be sure to read the highlighted areas.-Lisa T.
My posting of today at the Research Gate: “By Sรธrensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike
https://www.minervanett.no/โฆ/13/TheEvidenceNoNaturalEvol.pdf,
This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.
“The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte“
“SARS-CoV-2 is possessed of dual action capability“
“Simultaneously it is capable of binding to ACE2 receptors“
“The likelihood of this being the result of natural processes is very small.”
“The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”
“A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”
“Why does this matter?”
“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”
“the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved“
“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”
“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”
“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”
“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”
“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”
“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”
“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”
“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”
“a designed mutated strain (initially) lacking the furin cleavage site residues was used”
“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”
“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:
1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!
“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”
“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”
“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”
“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!
“typically the objective of gain of function experiments… a strong indicator of manipulation”
“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”
“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!
Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”
“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”
“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.
“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…
“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!
“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!
“we now add here a forensic analysis”!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:
“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”
“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBDโs between bat SARS-like and human SARS viruses (they state): โ… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”
“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”
Note:
So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!
But the fight continues as follows:
“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirusโs ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 โ 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”
And the next one is a “classic” of infamy:
“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”
“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.
“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”
“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”
“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”
“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.
“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”
“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.
So, “the reconstructed historical etiology of the Spike (is) as follows:”
“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBDโs between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”
Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”
Additionally, in this wretched document;
https://apps.who.int/โฆ/annual_reโฆ/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/โฆ/annualโฆ/GPMB_annualreport_2019.pdf ),
We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”
Protected: Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon-Ed Level Advanced
Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.
Here are the sequences of Covid19
As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.
I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.
Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!
The main analyzed regions
Region ยซ A ยป, Location of the 600 bases from the COVID_19 reference genome โWuhan marketโ ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.
AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC
See details alignment in supplementary materials ยซ a ยป.Region ยซBยป, Location of the 330 first bases from the COVID_19 reference genome โWuhan marketโID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region ยซAยป:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220
TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT
See details alignment in supplementary materials ยซ b ยป.We analyzed this larger region which starts at the same address as our region “B”: entitled ยซ Region Lyons-Weiler ยป [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:
TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA
Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.
For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.
Fernando Castro-Chavez is with Lambert Dolphin.

9 hours ago
Whatever They Make and Market is Either Culling or a Placebo. It’s Not Medicine.
Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.
As you skim, please be sure to read the highlighted areas.-Lisa T.
My posting of today at the Research Gate: “By Sรธrensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike
https://www.minervanett.no/โฆ/13/TheEvidenceNoNaturalEvol.pdf,
This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.
“The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte“
“SARS-CoV-2 is possessed of dual action capability“
“Simultaneously it is capable of binding to ACE2 receptors“
“The likelihood of this being the result of natural processes is very small.”
“The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”
“A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”
“Why does this matter?”
“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”
“the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved“
“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”
“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”
“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”
“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”
“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”
“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”
“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”
“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”
“a designed mutated strain (initially) lacking the furin cleavage site residues was used”
“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”
“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:
1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!
“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”
“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”
“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”
“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!
“typically the objective of gain of function experiments… a strong indicator of manipulation”
“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”
“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!
Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”
“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”
“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.
“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…
“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!
“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!
“we now add here a forensic analysis”!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:
“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”
“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBDโs between bat SARS-like and human SARS viruses (they state): โ… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”
“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”
Note:
So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!
But the fight continues as follows:
“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirusโs ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 โ 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”
And the next one is a “classic” of infamy:
“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”
“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.
“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”
“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”
“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”
“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.
“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”
“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.
So, “the reconstructed historical etiology of the Spike (is) as follows:”
“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBDโs between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”
Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”
Additionally, in this wretched document;
https://apps.who.int/โฆ/annual_reโฆ/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/โฆ/annualโฆ/GPMB_annualreport_2019.pdf ),
We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”
I Haven’t Written about Intimacy in Awhile
…because a panicdemic isn’t exactly an inspiration to intimacy.
IT’S A DIFFERENT WORLD SINCE I LAST REALLY POSTED ANYTHING!
I’m just going to say it. If you’re well and have faith in your immune system, know that you make antibodies as everyone does and feel like you can walk above the Fear Fray, HAVE SEX!
I’m above the fear fray. I’m incapable of following the crowd on this. Literally. I watch NO T.V. Because I know better. Being holistic, I know the facts about the body and take care of myself.ย I don’t rely on doctors and their pills. I use herbs and take Chinese anti-viral herbs that make it impossible for a virus to go into your lungs. YEAH, THEY SHOULD BE ALL OVER THE HOSPITAL but there is no way Big Pharma would let Chinese herbs that work in there, even if they can save lives.
Being who I am, I know how to pretend I’m complying and then do the little actions and use the little wipes, hand washing like it’s a religion, social distancing, blah, blah, blah that everyone thinks is SO powerful and make my office smell like Lysol which is actually not good for us. I actually do it, probably more than the fear people because I coddle the fearful people too much. I feel sorry for them having no faith whatsoever in their bodies.
It’s because they THINK THAT and FEEL that that gives it power. I feel it already without the little anti-microbial everything. Someone do me and people LIKE ME a favor and have a better understanding of how your body really works and some FAITH in your very powerful immune system. We never get that satisfaction. We just get to see darting eyes behind and mask and FEAR oozing out of every part of your body while you walk really fast from the grocery store. Do you know how TOXIC that is?
This whole thing is killing intimacy of any kind and sex and I find it very, very sinister to the social fabric of humanity. We’ll see if they really intend to open up normal movement again. Just start doing it yourself quietly. If everyone does without making a fuss then who is going to stop them?
What is intimate is the virus itself. It’s microscopic folks. It’s smaller than any moisture cells that come out of your mouth during a sneeze. The mask everyone is making like Betsy Ross made the flag aren’t helping with anything. If you sneeze, the microscopic virus goes right through the fibers of the mask. Outside particles in the air go right into and through because they’re microscopic. The only mask that stops it is N95 and I have one. A healthcare worker gave it to me so I could work on her. It’s asphyxiating meaning it works to keep out the virus. Oxygen can barely get in which means nothing in the air is getting in. That’s how you know it works. And you could faint wearing it. So the masks that do work don’t allow you to breathe. There’s a quick death. The whole mask issue is one of psychological false sense of security. If your vibe is full of fear you weaken your immune system.
Anyway…your mind (thoughts and feelings) control your immune system. There are all kinds of nasties, every day of your life in your body that if multiplied, would kill you quickly. Mammals are full of destructive microbes! All the time! We don’t die because our immune systems are 1 million years old of brilliant and are on vigilant guard and go after anything that gets out of line UNLESS, we tell them to stand down and let the killing begin. Meaning, you, the host, feel weak and sad and want to die. That doesn’t usually happen but this would be a good time to split if you felt like it. No one would question you, no hassle. The virus would be blamed, you would not be.
I feel the lack of intimacy and socializing is worse for people than the virus. We are meant to be together. This distrust of our bodies and the immune system is nonsense. That said if you feel weak and full of fear you should stay home because your vibe is toxic. Maybe not just now but all the time. You’ve got some meditating to do and choices to make about your relationship with Life.
Intimacy; Panicdemic

…because a panicdemic isn’t exactly an inspiration to intimacy.
IT’S A DIFFERENT WORLD SINCE I LAST REALLY POSTED ANYTHING!
I’m just going to say it. If you’re well and have faith in your immune system, know that you make antibodies as everyone does and feel like you can walk above the Fear Fray, HAVE SEX!
I’m above the fear fray. I’m incapable of following the crowd on this. Literally. I watch NO T.V. Because I know better. Being holistic, I know the facts about the body and take care of myself. I don’t rely on doctors and their pills. I use herbs and take Chinese anti-viral herbs that make it impossible for a virus to go into your lungs. YEAH, THEY SHOULD BE ALL OVER THE HOSPITAL but there is no way Big Pharma would let Chinese herbs that work in there, even if they can save lives.
Being who I am, I know how to pretend I’m complying and then do the little actions and use the little wipes, hand washing like it’s a religion, social distancing, blah, blah, blah that everyone thinks is SO powerful and make my office smell like Lysol which is actually not good for us. I actually do it, probably more than the fear people because I coddle the fearful people too much. I feel sorry for them having no faith whatsoever in their bodies.
It’s because they THINK THAT and FEEL that that gives it power. I feel it already without the little anti-microbial everything. Someone do me and people LIKE ME a favor and have a better understanding of how your body really works and some FAITH in your very powerful immune system. We never get that satisfaction. We just get to see darting eyes behind and mask and FEAR oozing out of every part of your body while you walk really fast from the grocery store. Do you know how TOXIC that is?
This whole thing is killing intimacy of any kind and sex and I find it very, very sinister to the social fabric of humanity. We’ll see if they really intend to open up normal movement again. Just start doing it yourself quietly. If everyone does without making a fuss then who is going to stop them?
What is intimate is the virus itself. It’s microscopic folks. It’s smaller than any moisture cells that come out of your mouth during a sneeze. The mask everyone is making like Betsy Ross made the flag aren’t helping with anything. If you sneeze, the microscopic virus goes right through the fibers of the mask. Outside particles in the air go right into and through because they’re microscopic. The only mask that stops it is N95 and I have one. A healthcare worker gave it to me so I could work on her. It’s asphyxiating meaning it works to keep out the virus. Oxygen can barely get in which means nothing in the air is getting in. That’s how you know it works. And you could faint wearing it. So the masks that do work don’t allow you to breathe. There’s a quick death. The whole mask issue is one of psychological false sense of security. If your vibe is full of fear you weaken your immune system.
Anyway…your mind (thoughts and feelings) control your immune system. There are all kinds of nasties, every day of your life in your body that if multiplied, would kill you quickly. Mammals are full of destructive microbes! All the time! We don’t die because our immune systems are 1 million years old of brilliant and are on vigilant guard and go after anything that gets out of line UNLESS, we tell them to stand down and let the killing begin. Meaning, you, the host, feel weak and sad and want to die. That doesn’t usually happen but this would be a good time to split if you felt like it. No one would question you, no hassle. The virus would be blamed, you would not be.
I feel the lack of intimacy and socializing is worse for people than the virus. We are meant to be together. This distrust of our bodies and the immune system is nonsense. That said if you feel weak and full of fear you should stay home because your vibe is toxic. Maybe not just now but all the time. You’ve got some meditating to do and choices to make about your relationship with Life.


You must be logged in to post a comment.