When you Raise Your Spiritual Consciousness It Changes your DNA


Balance and understand your female and male side in your personality to align your karma and dharma. That will raise your spiritual consciousness and change your DNA in a favorable manner.

Corey Goode in the video I just posted.

Corey Goode on Future Timelines, Which is the AC Strand of the DNA. It’s explained in My Book.


This is initiated by the Solar-Prophetic Outbreath on the Interplanetary Holon. It begins with White Dog, tribe 10, and moves up to Blue Storm, tribe 19. Remember that Sun/Storm is the 0-19 code.

Corey is Yellow 7 Solar Resonant Sun. It is unique in that its 5GForce is itself. This is the only kin like this. Analog is Blue 7 Storm, G.P. is Yellow 7 Human, Antipode is White 7 Dog, Hidden Wisdom is Red 7 Dragon and 5GForce is Itself.

Watson and Crick Were Silenced by the Deep State and Watson Had His Nobel Prize Taken Away for One Comment he made


I can hardly stand having this on my computer, it’s such bad energy. This is James Watson; founder of our CURRENT science on DNA? Holy Crap. I 100% disagree with him based on what we know now about the Tzolkin and Time and EPIGENETICS. OUR MINDS and OUR CHOICE control our DNA. We ARE equal in our ability to choose. IMO his statement is ignorant, but none of us are 100% correct. Still, something in humans tells us that because we are all equally loved and cared for by the Universe, we can make a go of it with what we’ve been given and that has NOTHING to do with our Birth Genes.

All that and Rosalind Franklin’s Photo 51 was responsible for SHOWING the Double Helix. She was ignored. The Three Men Won the Nobel Prize.

I wonder if they worked with Operation Paperclip? This link is really something and just brings up more questions for me. Be sure and look at this website and it’s videos and the video below.

https://dnalc.cshl.edu/view/15470-The-moral-responsibility-of-scientists-in-Nazi-Germany-James-Watson.html

Francis Crick and James Watson, Molecular Biologists

The Tzolkin Themeplex for the day of discovery of DNA by Watson and Crick; February 28, 1953. 8Histidine.

8Histidine is the Amino Acid of a Galactic conflict. Still, at least their work was guided by our Sun. But look at the antipode; 8Threonine is death and change. And there is 6Serine, the Reptilians underneath. It’s pretty straight forward. “You would be wise to keep some of what you see under your hat for now.” The Reptilians back in 1953

1-Crick
Francis Crick in his office in his later years. Author: Marc Lieberman
2-Crick
Francis Crick and James Watson

Crick asked himself how it was possible that nature had simultaneously invented two mutually interdependent elements of life: the genetic material –nucleic acids, such as DNA or RNA– and the mechanism necessary to perpetuate it –the proteins called enzymes–.

The synthesis of the nucleic acids depends on the proteins; the amino acids, but the synthesis of the proteins depends on the nucleic acids. Faced with this chicken-and-egg problem, Crick and his colleague Leslie Orgel reasoned that life should have arisen in a place where there exists a “mineral or compound capable of replacing the function of the enzymes, and from there it would have been disseminated to other planets like Earth by “the deliberate activity of an extraterrestrial society.”

The truth is that directed panspermia does not detract from Crick’s thinking at all. Quite the contrary, it reveals the powerful workings of a theoretical, incisive and restless mind, eager for rational answers, even unconventional ones. To understand how Crick came to the idea of panspermia, we must go back a few years. The son of shoemaker Weston Favell (Northampton, UK), Francis Harry Compton Crick (June 8, 1916 – July 28, 2004) reached the end of his childhood with the main aspects of his identity already defined: his penchant for science. As for the first, he chose physics.

Molecular biology might have lost one of its founding fathers had it not been for the war. Crick began his research at University College, London working on what he described as “the dullest problem imaginable” – measuring the viscosity of water at high pressure and temperature. With the outbreak of World War II, he was drafted into the army to work on the design of mines. After the end of the conflict, he discovered that his equipment had been destroyed by a bomb (in his autobiography he spoke of a “land mine”), which allowed him to leave this tedious research.

Crick then had to choose a new field of research, and that was when he discovered what he called the gossip test: “what you are really interested in is what you gossip about.” In his case it was “the borderline between the living and the nonliving, and the workings of the brain,” in a nutshell – biology, or, as a physicist – biophysics. He began working on the structure of proteins in the Cavendish Laboratory of Cambridge, until he met an American named James Watson, twelve years younger than him but already with a PhD that Crick had not yet obtained for himself. Watson & Crick, and their DNA model in the Cavendish Laboratory (1953). Author: Antony Barrington Brown

The two researchers discovered that they shared a hypothesis. At that time it was believed that the seat of inheritance lay in proteins. Crick and Watson thought that genes resided in that unknown substance of the chromosomes, deoxyribonucleic acid (DNA). And that conviction, along with the participation of Maurice Wilkins and Rosalind Franklin, would give birth on February 28, 1953 to one of the greatest discoveries of twentieth century science, the double helix of DNA. The work was published in Nature on April 25 of that year. Crick would not obtain his PhD until the following year.

But although Crick is known primarily for being one of the founders of this milestone of molecular biology, the truth is that he himself laid the first rails of this new science. It was he who proposed that DNA was transcribed to RNA and that this was translated by means of adapter molecules in charge of converting the genetic code for proteins, the building blocks of life. And it was this “central dogma” of biology, as he himself baptized it, which led him to publish in 1973 his hypothesis of panspermia, by then such an elegant idea that it even counted astrophysicist Carl Sagan among its proponents.

Only years later would it be discovered that RNA can act by itself as an enzyme without the intervention of proteins, thus solving the problem that inspired panspermia. In 1993, Crick and Orgel published an article that no longer made any mention of an “extraterrestrial society”.  (Who shook that out of them? Scientists have always been pressured to agree with the Government/Military/D.S. narrative)The chicken-and-egg problem “could be resolved if, early in the evolution of life, nucleic acids acted as catalysts,” they wrote.

By this time Crick had changed continents and fields of study; in 1976 he moved to the Salk Institute in La Jolla (California, USA) for a one year sabbatical that would end up lasting for almost three decades. It was there that he settled his unfinished business with the second of his gossips: the brain. For the rest of his career, and in collaboration with neuroscientist Christof Koch, at the California Institute of Technology (Caltech), he devoted himself to trying to locate consciousness in the brain matter. “You, your joys and your sorrows, your memories and your ambition, your sense of personal identity and free will, are in fact no more than the behavior of a vast assembly of nerve cells and their associated molecules,” he wrote in 1994.

He never managed to unravel the problem of consciousness, although he made significant advances in the knowledge of visual perception. In 2004, he lost his battle against colon cancer, but never lost the courage or the passion for the study of life. According to Christof Koch, “he was editing a manuscript on his death bed, a scientist until the bitter end.”

This is from History.com

They saw Rosalind Franklin’s photo 51 of the DNA that SHOWED the double helix just before their announced their discovery. Her student Wilkins showed it to them but she never learned that he did that. Wilkens then shared in the Nobel Price so it was just the three men and Rosalind was ignored.

On February 28, 1953, Cambridge University scientists James D. Watson and Francis H.C. Crick announced that they have determined the double-helix structure of DNA, the molecule containing human genes. The molecular biologists were aided significantly by the work of another DNA researcher, Rosalind Franklin, although she is not included in the announcement, nor did she share the subsequent Nobel Prize award for it.

Though DNA—short for deoxyribonucleic acid—was discovered in 1869, its crucial role in determining genetic inheritance wasn’t demonstrated until 1943. In the early 1950s, Watson and Crick were only two of many scientists working on figuring out the structure of DNA. California chemist Linus Pauling suggested an incorrect model at the beginning of 1953, prompting Watson and Crick to try and beat Pauling at his own game. 

LISTEN NOW: HISTORY This Week Podcast: The DNA Debate

On the morning of February 28, they determined that the structure of DNA was a double-helix polymer, or a spiral of two DNA strands, each containing a long chain of monomer nucleotides, wound around each other. According to their findings, DNA replicated itself by separating into individual strands, each of which became the template for a new double helix. In his best-selling book, The Double Helix (1968), Watson later claimed that Crick announced the discovery by walking into the nearby Eagle Pub and blurting out that “we had found the secret of life.” The truth wasn’t that far off, as Watson and Crick had solved a fundamental mystery of science–how it was possible for genetic instructions to be held inside organisms and passed from generation to generation.

Watson and Crick’s solution was formally announced on April 25, 1953, following its publication in that month’s issue of Nature magazine. The article revolutionized the study of biology and medicine. Among the developments that followed directly from it were pre-natal screening for disease genes; genetically engineered foods; the ability to identify human remains; the rational design of treatments for diseases such as AIDS; and the accurate testing of physical evidence in order to convict or exonerate criminals.

Crick and Watson later had a falling-out over Watson’s book, which Crick felt misrepresented their collaboration and betrayed their friendship. 

A larger controversy arose over the use Watson and Crick made of work done by another DNA researcher, Rosalind Franklin. Colleague Maurice Wilkins showed Watson and Crick Franklin’s X-ray photographic work to Watson just before he and Crick made their famous discovery. The imagery established that the DNA molecule existed in a helical conformation. When Crick and Watson won the Nobel Prize in 1962, they shared it with Wilkins. Franklin, who died in 1958 of ovarian cancer and was thus ineligible for the award, never learned of the role her photos played in the historic scientific breakthrough.

Citation Information

Article Title

Chemical structure of DNA discovered

Author

History.com Editors

Website Name

HISTORY

URL

https://www.history.com/this-day-in-history/watson-and-crick-discover-chemical-structure-of-dna

Access Date

March 22, 2021

Publisher

A&E Television Networks

Last Updated

March 2, 2021

Original Published Date

November 24, 2009TAGSSCIENCEBY HISTORY.COM EDITORS

© 2021 A&E Television Networks, LLC. All Rights Reserved.

Update of TSR as of Late Last Night


I showed you folks this which is a table I created on my laptop. It’s all condensed and all the tables are in my book; “Time is DNA”.

which was transferred from this which I did by hand months ago;

They are the same thing. What I realized yesterday is that there are two different polarity designations which I did not see before. the 0’s and 1’s are computer binary code designation as the Tzolkin “could be” translated into binary code. I was going to do that but it would need to be processed through a QUANTUM COMPUTER. The Tzolkin is far past our 64/32 bit computers as it’s multidimensional. In fact, the only thing on earth that processes it precisely is OUR BODIES. Our bodies ARE ONE WITH THE TZOLKIN and The Universe. Think of Baby Yoda. LOL!! Don’t tell the biologists, white coat doctors, 3D clenching microbiologists, virologists and god knows who else, that truth. They don’t believe it anyway. Their careers will be ruined by HUMANS knowing the power of the DNA in every cell of their body WHICH WE CAN PROGRAM OURSELVES along with the superpower of our blood.

So, the way the Tzolkin aligns the anode and cathode, positive and negative electrical charge of the molecules is in a different order than the I Ching Square of 8. The above alignment is a study in the I Ching Hx’s which are in order specifically according to Hx number. They are not numerically progressive. The order is based on something else.

For instance, the Square of 8 starts with Hx 56 and Tzolkin starts with Kin#1. They are two very different oracles with different spins and electromagnetic realities. I believe that’s because they communicate our cellular alignment in different dimensions (if that can be said). I don’t know. Science says the dimensions are ONE but I have see HOW in these Oracles. The hexagram numbers adding up to 260 horizontally is a fascinating start. Again, Jose did not do the work of joining the two oracles and examining them as amino acids. I’m doing that.

This is the Tzolkin alignment of polarities which make the DNA spin in the double helix. Again, I had to figure this out by hand myself. There was no document to look at. I deduced it from “Earth Ascending”. Jose didn’t figure this out. I did. But he drew graphics “pointing” to it.

But now, I have to figure out the polarities according to the 64 hexagrams which are helter skelter, in no particular order and get those corrected on the I Ching square of 8.

My Mom asked me on the phone last night, “Don’t the Stellar Species already have this information?” That’s a fair question and reminds me of what Corey Goode said are assumptions about E.T.’s by humans; that they are further advanced than us or smarter. No, they are not. They actually do homage to us when they meet us. It’s a mutual admiration society but not all E.T.’s are ahead of us.

Why would they be? They’re not from this planet. Some are geneticists but they don’t necessarily see it the way we do. Some of them seeded us here and monitored our evolution but The I Ching and the Tzolkin were both IMPORTED here by Red Dragon Tribe and probably Yellow Star Tribe for the Tzolkin. Humans are different but not all together different. We are ONE universal family, but just like humans on this planet have different perceptions and cultures the same is true of our DNA spread among stellar species. I’m trying to prove we are more alike than different but that takes examination.

The Maya came from Venus so it was either Blue Monkey or Yellow Star. The oracles are recent in Earth’s 14 billion year history before there were any humans here at all. The human species is only approximately 1 million years old. We basically just got to the planet and have been in charge of our own evolution to a great degree.

If I Miss A Day…


It’s because I’m finally making big headway on my book; ‘DNA is TIME 13:20. I figured out how to get my large, complex document that illuminates the binary triplet configuration according to the Square of 8 into the book. I put each Tzolkin themeplex into each square of the 64 harmonics and found amazing patterns.

I’m still studying it and now the biologists will be able to also. I used the single letters for each of the amino acids with the tone in front of it and added a few more key components for analysis on the table.

It will take up eight pages of my book and I’m thrilled I figured out how to fit it in. Explaining it will be another challenge.

I took all of it off of my laptop to be safe. My instinct is it may not be safe to publish until the Deep State is off the planet and our local system is cleaned up of n’er do wells. It may be a few years. U.S. Space Force has it’s work cut out for them.

This information will help all species; human and stellar understand how we are one family OF TIME in the Universe. We are all held by the Creator, not withstanding certain universe mistakes that need a hearing.

Peace comes by unity in diversity. It’s not just earth that needs healing. We have to understand that even though we look very different we share the same DNA.

Image from Earth Ascending by Jose Arguelles

Sunday; Blue 10 Planetary Monkey; Analog Yellow 10 Star. We can change our own DNA by Receiving Downloads Via The Sun.


RED 4 SELF-EXISTING MOON is our 5GForce. It is METHIONINE or the START CODON.

We’re already into the antipode for the day which is Red 10 Planetary Dragon. The Guide Power from dawn to noon was Blue 10 Planetary Storm and it has been super stormy in Michigan.

With Red Dragon we move into some memories of our mothers, our ancestors, our feelings about that, nurturing and Being. Don’t hesitate to make this upcoming Thanksgiving and Solstice extra special since this is a CAPSTONE, a PINNACLE, the top of the mountain as far as our evolution and balancing for the planet. It’s not comfy and easy but it is getting better. We are getting more and more disclosure and RECKONING between right and wrong, dark and light spirituality.

We also have the opportunity and ability to do DIRECT DOWNLOADS from the sun for new RNA sequences to balance our own damaged DNA issues so that we can slowly come into our LIGHT BODIES as the EARTH comes into HER LIGHT BODY.

It just happened to me with my left leg. I had been working on it myself for months doing deep manual therapy and Reiki, I lay on my bed in the direct, hot sun last Wednesday and automatically received a crazy download like a computer software program of numbers and symbols really fast INTO MY CLOSED EYES. I just relaxed knowing that I was being helped or given information from our ancestors. I know how to receive information I don’t understand and not try to analyze it. Then I went about my day.

That night I felt lightly virusy and got the chills and ran a fever of 100 degrees +, no biggie, but I felt sick. Then my left leg that had been crushed (the soft tissue) 47 years ago, where I had been working on dense scar tissue, got very red and felt very strange. I couldn’t walk on it for three days. I knew from looking at it that the BLOOD finally released like a damn into my old injured ankle and foot. When blood circulation is blocked in injured tissue the tissue cannot heal. That tissue has to be released but of course sick care industry has no clue and never pays attention to the flesh medically. I very gently worked on it and it was getting better quickly. How was this old injury related to what I interpreted as a virus?

It was not “an illness” which is what we think of as “a virus” I was told. The only way these RNA packets can explode in our earth bodies is if they turn on or challenge the IMMUNE SYSTEM with a certain amount of stress. Just bc your immune system is challenged doesn’t mean you are literally sick. True sickness is when you sit in a very negative mind and heart set over time and cause DIS EASE or UN EASE in your soul. Then you get very sick. I had asked and wished, multiple times for that lower leg to be the way it used to be so I would no longer have neuropathy in that foot! It would keep me up at night.

It’s gone now folks. My foot is normal. The ankle is almost normal. The leg is already. The download was a mental RNA packet coming into this dimension as a challenge to my immune system to uptake the new sequence. We have to allow this or we won’t evolve upward. Some entities on this planet would prefer that. I don’t prefer it. That then mutates my own DNA and makes it what it was before in that leg. EVERY MOLECULE OF OUR BODY HAS DNA. Every molecule of our body exists and has existed IN TIME. OUR SUN REGULATES ALL OF IT AND HAS THE CODES THAT EACH OF US NEEDS. There are two suns; the sun we see and the sun that is hidden which is directly tied to Galactic Center. There is no limit in time or space (physical holographic projection in our world) of what is possible. It’s up to OUR MINDS TO FOCUS and CHOOSE what we want. Now it’s time to do it. We can do it and I’m giving you the HEADS UP!

I desperately want my BODY in THIS TIME AND DIMENSION to be WHOLE AND AGELESS. I’m going to have it because I have plenty to do on this planet before I take off. Dare you to try it.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

The Most Logical Explanation is that CV2 Comes from a Laboratory.


The well-known Norwegian virologist Birger Sørensen and his colleagues have examined the corona virus. They believe it has certain properties which would NOT evolve naturally. These conclusions are politically controversial, but in this interview he shares the findings behind the headlines.

Here is the rundown at this link.: https://archive.vn/Wmj9p

It’s an excellent article.

A few books I’ve read cover to cover. But no PhD behind my name…officially. I’m too intuitive for academia.

Wednesday. Self-create or React? Act or RE Act?


RE-acting is mimicry. Monkeys and parrots mimic. Humans also mimic unless they are mentally mature. Babies learn by mimicking but adults learn by creating. Humans are addicted to mimicry because of a lazy streak usually due to unresolved childhood issues. They’re still grieving parenting they didn’t get. That ship has sailed. You can parent yourself with the help of the universe and rival your parents. Don’t you want to win? I want my son to win over any mistakes his father and I made. Self-Creating, self-generating (Blue Storm tribe), Acting is all ART and comes from your Magic Nation or imagination.

Think of these two as a teeter tooter where you are deciding whether to go one route or another. In this case, are you going to DIY and send up a plan in your mind or are you going to continue your normal REACTIVE route where first you have to pull in something from outside of you such as another’s idea, T.V. , Twitter or Instagram and react to it, or are you going to sit quiet or workout, meditate, listen to your body and intuition and create your own plan from within yourself?

We are each at the precipice right now. Tone 2 is stabilizing by polarizing. It’s a simple choice; Self create, or React? Self create or React? The first one is INtegrity the second one is wash, rinse, repeat for your entire life and wastes everyone’s time and resources and nothing original is added to the planet.

Self-creating and acting involves:

  • Body care-organizing fresh food
  • Physical Activity
  • T.V. OFF
  • Water intake
  • Hand held device-limited
  • Organizing your money and bills
  • Meditation up to an hour a day
  • Boundaries with people who vampire your energy
  • No large group activities right now. Stay away

All of that is stabilizing. Stabilize yourself and don’t look outside of yourself to get someone or something to do it for you. Your MIND, your BRAIN is a magnet that turns your body into a magnet. It’s literal. The media is trying to program your mind to give your authority and magnetism over to them. Don’t let them in. Our immune systems, bodies, and minds are the province of US and the Universe has our backs. Freedom and balance are universal law. We are supposed to be evolving in freedom and balance otherwise we’ll be programmed to go over the cliff. That gets rid of the weak-minded ones. They obey.

5GForce: Yellow 12 Sun; I dedicate in order to enlighten. Universalizing Life, I seal the matrix of universal fire with the crystal tone of cooperation. I am guided by the power of free will.

SCIENCE STUFF

Yellow 2 Sun Themeplex

  • THEME; Yellow 2 Sun is the Stop Codon
  • ANALOG: Blue 2 Storm or Tryptophan
  • GUIDE POWER; Yellow 2 Human or Glutamic Acid has the extra carbon-hydrogen molecule which humans needed to evolve once we were on the planet
  • HIDDEN WISDOM: Red 12 Cysteine or Red Dragon. Notice the Sulfur molecule in Red Dragon. The Earth began in sulfur and Red Dragon is the first tribe.

Time Innovation: What is the Binary Triplet Configuration in the Tzolkin?


abstract technology science concept DNA binary on hi tech blue background

The Tzolkin is a 260-day cosmic cycle that syncs precisely with ALL of our solar cycles and events to coordinate manifested time in our matrix as 13:20. It can’t be hacked, and our matrix is holistic and holonomic, not a simulation of a soulless machine world with a selfish male God who has a white beard sitting in a computer room. Our lives aren’t sci-fi. More like bio-non fiction or bio-truth.

The 260-day cycle is divided vertically in half by 2, 13-day cycles that program our two stands of RNA-DNA in every cell of our body. That’s the TWO, or binary part. In addition, there is anion and cation, anode and cathode, positive charge and negative charge that creates an ELM spiral that can and does reverse direction, which is basically a time changer like in Harry Potter. Hermione had one, which is just an archetype for our mental focus, which is what all human talisman are. We are challenged to focus bc of our limbic brain.

Then, the 3 parallels are the N. Polar Zone, The Zone of Transformation, and the S. Polar Zone that are synonymous with the earth, our bodies, and the planets in our local system. That the THREE in triplet. These sections are also split by positive and negative, and it all spirals in a magical dance of collective and I individual MIND, which creates gravity, which creates time and timelessness depending on your focus. In the body, time is on the left and right sides of the body ND brain. But the brain and spine down the center are timelessness, a stargate of illumination and remote viewing, and our connection to eternity.

Thr N. POLAR Zone is 5 lines of 13. The Zone of Transformation is 10 lines of 13. The S. Polar Zo e is 5 lines of 13. The vertical 20-day runs are 13 lines. 20:13 is 260.

You can see the Tzolkin in the image. The matrix overlays the earth multidimensionally and is programmed by our Sun, which is sentient in communication with Galactic Center. That universal program is beyond my pay grade.

                                                    
Jose Arguelles, Author of The Dreamspell and Earth Ascending.

Saturday. Dissolving Walls with Histidine


Histidine is an amino acid that is responsible for tremendous bursts of energy from every cell in our bodies. With it’s analog Alanine, it affects the function of our muslces. It’s a survival, thriver amino acid that has allowed the human race to accomplish amazing feats and is tied to our cortisol levels which affects energy level.

SCIENCE CORNER

Effects of Histidine and β-Alanine Supplementation on Human Muscle Carnosine Storage

Carnosine is a di-peptide molecule, made up of the amino acids beta-alanine and histidine. It is highly concentrated in muscle and brain tissues. Carnosine and carnitine were discovered by Russian chemist Vladimir Gulevich.

https://pubmed.ncbi.nlm.nih.gov/28106620/

Also in this themeplex we have White Worldbridger or Threonine as the antipode and Red Serpent or Serine as the Hidden Wisdom. There is an amazing amount of carbon in all of these molecules which helped humans evolve flesh onto our bones.

These molecules have very strong synchronicity with each other which is another sign that their line-up in the Tzolkin Harmonic Code is connected to our lives on earth. Through a binary triplet configuration and the 13 Tones of Creation, these 3D proteins fold into everything in our world. Once the scientists accept that what is esoteric underpins the nature of things, this information will be tested and processed to create a real healthcare system with a philosophy of Whole systems.

Classical Binary Bit; 1-3D. Qubit; 4-5D.


This is a great image of a classical bit (0’s and 1’s) vs. Qubit. What does this have to do with DNA? Everything. Our ancient human 64-bit divination programs based on culture are DNA information left on the planet by our ancestors that helped us evolve here. There are many different 64-bit programs all over the world.

The 64 bit DNA illumination from other cultures IS THE BASIS for our current 64 and 32-bit computer programs. Is our tech trying to change and program our DNA? LOL😆 Yahhhhh. Is it altruistic or sinister? It depends on the soul state of the individual using it. You can use any tool for lightwork or dark work. That’s what we’re learning about on Earth.

The SPACE between the 0 and the 1 is what computer programmers want to avoid. It’s the mysterious electromagnetic twilight zone that can blow your circuits and I believe they have figured out how to do it. Still, sometimes computers do crash and their speed and capability are very limited. So, like our current perception of our DNA it is dualistic. We’re in the dark ages on Earth folks.

The other qubit image is 4-5D so we get to uplevel to 4th and 5th dimension which is TIME and MIND or TIMEMIND. SPACETIME is 1-3D. This is my concept. I just created the word Timemind.© as I was typing. Copyright.🙏

I guess the quantum computers are working and it may take a quantum computer to illuminate or communicate the 13 Tones of Creation. I’ve got the Tzolkin figured out in classical binary. JOSE HAD IT FIGURED OUT he just didn’t want to sit there and write out all the 0’s and 1’s. 😆 which I am willing to do. There aren’t just 260 of them There are 260 x 5 lines of 0’s and 1’s as the Tzolkin Code, so 1300 lines of classical binary code. Gee, what fun.🤓🥳

But as you and I both know, each kin has a creative tone 1-13 in front of it. That’s not JUST a number or a musical note which would be easy to write in the classical binary. They are something else in quantum.

Sunday. A vision for empowering, commanding, radiant Love, Loyalty, and Heart. White 5 Dog


White 5 Dog; 5 Aspartic Acid

Code0-19: 18:10:5:70

Mediating planet is Mercury which is currently direct.

5GForce; White 9 Dog. Solar, Intention, realization and pulsing of love, loyalty and heart. Get woke!

This is a day for acting and speaking from a flowing open heart that then looks into the mirror guided by clarity, truth, discernment, and commitment. Once that vision is clear from within you, according to your passion and your rational mind, it’s uploaded to Galactic Center Via our Sun.

This it the themeplex today.

I don’t usually use these because I’m not crazy about the art but it does help you see the archetypes and their relationship to one another. The theme is in the center. It’s the nucleus of a DNA molecule. On the right is the analog which is sort of co-equal with the theme and is in the position of the attachment site on the tRNA molecule. Above is the guide power or the D-Arm of the tRNA. On the left is the antipode or the anticodon tRNA on the 3′ and 5′ end of the tRNA. And the hidden wisdom is in the T-arm position. This is my theory. I’m still working on proving it.

The Amino acids analog with these archetypes today are;

  • Aspartic Acid,
  • Methionine, the start codon,
  • Tyrosine, the
  • Stop Codon and
  • Asparagine.

It’s very significant that we have a start and stop codon in the same Tzolkin themeplex. The start and stop codon begin and end the mRNA translation in the sequence. Intuitively, thinking about both the function of the amino acids, their placement, and the attributes of the Tzolkin archetypes, I’d say that the DNA programming of radiant, overtone love from Galactic center is working on flowing and evolving in every nucleus of every DNA cell in every human body today. We need to roll with it, look…in…the…mirror and see ourselves through the eyes of love. Or, see ourselves the way God sees us; as her/his perfect children.

If you are a parent, you know that when your baby is born, they are perfect and you are in love. It was like that for me as a mother and my baby is now 21. I still adore him and want his happiness and health and want him to find the mate he needs and the career he needs to be of service on the planet more than anything else. Now imagine how our Creator feels about us only a bazillion times more. Yes, I see his flaws but forgive them and am patient with them. God’s love IS our love. That’s the only way we have it and it needs to break our hearts open with passion, vision, and forgiveness. We are one human family.

The function of the stop codon, YELLOW SUN, or ZERO is to upload all of that energy like an email to galactic center as a status report. That’s going on right now. From noon-sunset, up it goes. Once we hit dusk it’s Blue 5 Monkey, time to play, relax, hang out until midnight. Happy Sunday.

SCIENCE CORNER

SATURDAY; Red 4 Self-Existing Moon/Water-Methionine


Code0-19: 18:9:4:69

5GForce (Galactic 5th dimensional influence); Blue 10 Planetary Monkey or 10 Asparagine

Mediating planet is Mercury

The order of these in the Tzolkin gateway is Theme; Red Moon, Analog, White Dog, Guide Power, Red Serpent, Antipode, Blue Storm and Hidden Wisdom Yellow Human.

That is 4Methionine, 4Aspartic Acid, 4Serine, 4Tryptophan, and 10Glutamic Acid.

If they are indeed tRNA molecules, and so far my work shows they are an algorithm that programs human genes, they would fit in the tRNA themeplex above only flipped to the right. It’s an amazing synchronicity and I’m still working out the details. The Tzolkin names of the tribes are an archeological fact. In Mayan they are:

  • Imix
  • Ik
  • Akbal
  • Kan
  • Chicchan
  • Cimi
  • Manik
  • Lamat
  • Muluc
  • Oc
  • Chuen
  • Eb
  • Ben
  • Ix
  • Men
  • Cib
  • Caban
  • Etnab
  • Cauac
  • Ahau

The Maya claim to have crash landed on Earth as refugees from Venus. Earth tends to function as a safe port that way. The same thing happened with the blow up of Maldek which is our current, literal asteroid belt. The Malkekians that survived landed in Antarctica. The “people” on this planet tell us that the Venusians are super expert at genetic engineering so they were able to leave this information on the Yucatan Peninsula in their language for successive generations. The modern Maya have done just that. It’s very important for the humans on Earth to knows that we are a mixed species from all over the universe. Our DNA doesn’t originate here but it has most certainly evolved in a beautiful fashion here. Thus, we are at a turning point where we need so save our own skin from extinction. Fortunately we have help.

Thursday; Stabilizing Blue 2 Hand, that is if you apply your hand to the task!


Code0-19; 17:7:2:67; stabilizing knowledge, healing, and accomplishment

5GForce; Red 12 Skywalker, cooperative application, movement, and equality.

Tzolkin archetypes are Blue 2 Hand, Yellow 2 Human, Blue 2 Storm, Red 2 Earth, and White 12 Wizard.

Mediating planet is EARTH.

The task isn’t going to do itself. This political position of “waiting” for justice, for SOMEONE ELSE to give you what you want and deserve, for a UTOPIAN, even just and peaceful society from outside yourself is SO OVER. People are their own worst enemies but they don’t see it. They don’t see how their mindset and vibe are mis-creating and drawing to them circumstances that they don’t want. They’d rather blame and offload until someone gives them what they want; like a child.

Lashing out in revenge, taking others rights away is akin to a 2 year grabbing a toy from the other 2 year old saying, “If I can’t have the toy you can’t either!” Romper Room. We are no longer children. TAKE YOUR FREEDOM that is already intrinsic in YOUR MIND, apply it to your body, get moving, improve your brain, meditate, balance being still and taking action and stop, just stop, focusing on the situation OUTSIDE of you all that time that creates more negative emotion and gives you more excuses to not look at yourself in the mirror and admit that you don’t see the truth about yourself.

Usually it’s because you see your reflection in everyone else. You’re using others as mirrors instead of creating your OWN reflection. People say, “I can’t”. No. You won’t. It frightens most people to create their own reflections in their own vortex because then you do see there are no excuses and you CAN create yourself and be whoever you want to be. There is no more reason to be lazy, to whine, to complain across all of human society. But will you abuse your power which you’ve railed against in others for your whole life? Meditate on the illusion of competition. People get angry because they feel they have to compete for what they want and need. No you don’t. You have to ask to see the truth about how the universe works, not just the world of humans. You have to meditate and focus your mind and physical energy. That is the path. Getting a handle on your body is the first task.

There is no lack of anything in the universe. Whatever you focus your mind on that lines up consistently with your FEELINGS of what you want you will create. It does need to be deeply resonant though and you can’t doubt it. That’s where people trip up. Our world has taught people they’ll be rewarded for being fake. It’s not a real reward. It’s a ripoff. They think they can lie to themselves. No you can’t. Your life will be a mess.

Example; I really, truly want my next book; “DNA is Time” to be a smash hit. I want to be a very successful author and I couldn’t care less about naysayers or destructive people or jealous women and male scientists. Been there done that. I want my book to tantalize the public mind to say, “Hmmm. That’s interesting. I wonder.” The scientists should ponder what I’ve found and decide they want to run it in the lab. We need to have a public discussion about the nature of Time because mechanical time has truly f…… up society because it’s incorrect, just like our sick care system. I believe the non-political physicists would agree with me.

I could care less about being wrong or failing. Been there done that. I have no ego wrapped in this and I don’t enamor fame or money at all. I want my idea to be considered and for it’s valid points to be tested. I have NO DOUBT about my idea.

SCIENCE CORNER

The one under glutamic acid is tryptophan and phenylalanine which have some molecular synchronicity in the science lab and in the Tzolkin they follow each other exactly in this themeplex. It is of note that isoleucine has two carbon atom and glutamic acid has none but more oxygen. When humans landed on earth they relied more on carbon than oxygen until they became human and then became air breathers.

Who Invented the Mechanical Clock?


The mechanical clocks that we hang on our walls and the digital ones on our phones are all just human conceived interpreters of SOLAR SIGNALS from the SUN. They don’t actually receive solar signals accurately. Humans try but because we don’t have an accurate analysis of time, our clocks are never really exact although with our limited knowledge of dimensions humans claim they are exact.

The sun and our Minds control time, not the clock. Clocks have nothing to do with real time. Nature sets time, which we are part of, and it keeps changing since it’s a dimension. If you begin to live in the eternal moment you begin to realize that our Minds and thus our bodies exist in ALL dimensions at the same time which is timelessness. In truth, there is no time at that level. But there IS time just as we DO have a physical body and a physical earth for our learning at this level of perception; even though it’s a type of holographic time illusion. The measurement of the earth rotating around the sun is the beginning of how we measure time on earth and we then set our clocks as an interpretation of it.

I have a problem with that. (of course). Physical movement isn’t the only movement happening as the earth rotates around the sun in the same way that the Tzolkin isn’t only 1D, 2D, and 3D. Time is multidimensional. Even though physicists don’t know exactly how yet nor do they have the math figured out, they have enough math and empirical data to know it’s true.

Mathematical description

The precise definition of the equation of time is EOT = GHA − GMHA

The quantities occurring in this equation are:

Our simple understanding of time right now as far as physics goes is that time is the quantity of photon motion used to measure change in space. My gosh that’s Romper Room. I’ll grant that it includes 3D connecting to 4D there but it’s still locked in by our very, very, very limited 5 senses which causes humans to have extreme, illogical hubris. We think we can see the truth when we don’t even use our intuition or our higher reasoning.

With that cleared up, who invented the mechanical clock that tries to program people’s minds? Yi Xing, a Buddhist monk and mathematician of the Tang Dynasty (618-907A.D.) Given that the earth is billions of years old and humans are only 1 million years old approximately, our minds haven’t been entrenched with this “tool” yet. Mechanical clocks have only been around for about a thousand years. That’s the blink of an eye.

I hope at some point we have a type of Tzolkonic clock that runs on true time; 13:20 and literally does pick up the multidimensional fluctuation not only from the sun but the entire universe. I likely won’t be alive to see it but I trust the universe will allow that to manifest when earth is ready.

Oh wait, that receiver is our bodies. It’s us. We are the interpreters of time because multidimensional time is one with our DNA. Problem solved. I think the real virus are those clocks on the wall, like the T.V. and doctors who tell you “the facts” about your body with authority. Nada. We’re in charge.

My Hypothetical question and Hypothetical Statement as part of this Scientific Study.


Q: Is DNA-RNA movement equivalent to the movement of time?

Statement: “This study is designed to assess my hypothesis that the radial movement of RNA-DNA is the radial movement of time.

Once I’m done with my current phase of background research I am looking for interested scientists to help me;

  1. Design an experiment
  2. Collect data
  3. Analyze the results
  4. Draw conclusions
  5. Communicate the results