Why Does the Galaxy Matter to Us on Earth?


“The galaxy and galactic things figure prominently in the Mayan Tzolkonics. The Milky Way galaxy is the context within which all Life and thus all DNA lives in it’s myriad forms but that’s just the beginning”

White 8 Galactic Mirror is Tyrosine and has a 5GForce of White 6 Wind or pulsing spiritual communication.

The Universal context within which all Life exists is immense and beyond our human imagination but I won’t let that stop me. Today we are on White 8 Galactic Mirror so it is now time to take a look at much of what is beyond human knowledge that is not shared by our larger culture. The Urantia Book is one such thing and I’ll do my best to nutshell this particular piece.

Part I is The Central and Superuniverses. Part II is The Local Universe. Part III is The History of Urantia (Earth). Part IV is The Life and Teachings of Jesus in detail.

Our Milky Way Galaxy is the central nucleus of our Superuniverse Orvonton. It’s the seventh superuniverse. Orvonton is south of the Milky Way Galaxy and Earth and it are in the southeast sector of Orvonton on the outside edge. We’re edgy, maybe even leading edge. Our local neighborhood universe on the southeast edge or Orvonton is Nebadon. The local system in Nebadon in which we reside is Satania, I suppose named for the once highly regarded and ever trusted angel of light, Satan. Please note that now he is regarded as the epitome of dark. Even in the Universe, people aren’t too big to fail.

That all changed and there are multiple stories of the Great War in Heaven in every culture. There is one in the Urantia Book and it’s pretty awful. I’m not going into that now. We’re sort of going through it ON EARTH right now and are at the tail end of what the benevolent ancestors watching over us are going to allow. Humanity is held like a babe in it’s mother’s arms. We are very guarded and cared for despite how other humans feel about each other. The Universe does not regard us lowly. We are held in high regard and our evolution means EVERYTHING to our watchers, as human children are x 100.

The Master Universe encompasses all of material creation. It includes the central universe of Havona (Heaven), the seven superuniverses and the four uninhabited outer space levels which revolve alternately clockwise and counterclockwise around Havona. In outer space millions of new galaxies are in the process of formation. The first outer space level is about 500,000 light years beyond the periphery of the Grand Universe.

That’s just a nutshell of the context of our galaxy. In the order of things, The Tzolkin, The Network Grid, galactic energy is about modeling integrity and harmonizing. White Mirror reflects Order and Endlessness which is why I brought the Urantia Book into the mix today. I’ve read the whole thing over a thirty year period and pick it up often and read it again.

If you’re interested in the details of the Lucifer rebellion it’s on pages 601-620. If you don’t have the book it’s also online. Lucifer and Satan are apostate princes and I do believe their mischief is at it’s end now, as of a couple days ago. It says they fought against the Dragon which is likely synonymous with the Red Dragon Tribe, The Dragon Family of China and The Draco E.T. who were just recently routed from the planet by the Pleiadians. The Tzolkin teaches all of that history and the DNA is all in there. Earth is a hodge-podge, a pluralistic fertile pool if you will and now we’re trying to harmonize all of it.

https://urantia.org

Our Superuniverse filled with myriad of inhabited worlds

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

The Sun and the Solar Tone of Intention in The Matrix


Solar means sun. Today, solar energy is redundant in that we have the archetype of our star, the Sun as the Theme (a Stop Codon), and Tone 9 which is the solar tone of intention, light, life, realizing life and universal fire.

The Sun is in fact MIND, Big Mind as the Taoists say pulsing to us the scuttlebutt from Galactic Center. So much is going on right now. What has to be internalized asap in order for us to make this evolutionary leap is that OUR MINDS are…our bodies. Our immune systems are controlled by our minds and intentions, not by microbes. The microbes FOLLOW the magnetism of our minds. The virus SERVES evolution and is in fact, RNA in the case of a retrovirus. Due to that, it is constantly mutating and stands ready to turn into anything we unconsciously or consciously create. That was proven long ago. Even the M.D. admits the power of the mind and will over the body.

The microbes are not in charge. Microbes are very vulnerable to the environment (they die easily) and to the various defense mechanisms in our bodies. The media, if you listen to it like it’s God, has people’s MINDS programmed that this microbe is more powerful than you are. If you want and need it to be, it will be. They portray it as a war which is the beginning of modern medicine; THE BATTLEFIELD. That’s the number one mantra of course from the sick care system because they have a ton of profit to make off of convincing humans that they are SUPER WEAK and vulnerable like little children that need parents who are stronger and smarter than them. If you feel that way they’ve got you where they want you, you’re programmed and need to turn OFF the media and get meditating and tuning into your breath and your body. If you don’t, they’ll send you over the cliff as soon as they decide to flip the switch. Maybe that’s what you want.

I actually accept it now; that most people will not do the work of focusing their minds and bodies enough to become a co-creator. I really do accept it even though it’s not necessary.

The Moon is in Aquarius so we some action with Uranus opening up. Pluto is the mediating planet though between the Sun Tribe and Blue Storm tribe and it is quintile so we may be in the mood to challenge ourselves. In addition there is a square between Mars and Mercury both retrograde so communications could be snafu.

MOLECULAR LINE-UP

a

Wednesday. Self-create or React? Act or RE Act?


RE-acting is mimicry. Monkeys and parrots mimic. Humans also mimic unless they are mentally mature. Babies learn by mimicking but adults learn by creating. Humans are addicted to mimicry because of a lazy streak usually due to unresolved childhood issues. They’re still grieving parenting they didn’t get. That ship has sailed. You can parent yourself with the help of the universe and rival your parents. Don’t you want to win? I want my son to win over any mistakes his father and I made. Self-Creating, self-generating (Blue Storm tribe), Acting is all ART and comes from your Magic Nation or imagination.

Think of these two as a teeter tooter where you are deciding whether to go one route or another. In this case, are you going to DIY and send up a plan in your mind or are you going to continue your normal REACTIVE route where first you have to pull in something from outside of you such as another’s idea, T.V. , Twitter or Instagram and react to it, or are you going to sit quiet or workout, meditate, listen to your body and intuition and create your own plan from within yourself?

We are each at the precipice right now. Tone 2 is stabilizing by polarizing. It’s a simple choice; Self create, or React? Self create or React? The first one is INtegrity the second one is wash, rinse, repeat for your entire life and wastes everyone’s time and resources and nothing original is added to the planet.

Self-creating and acting involves:

  • Body care-organizing fresh food
  • Physical Activity
  • T.V. OFF
  • Water intake
  • Hand held device-limited
  • Organizing your money and bills
  • Meditation up to an hour a day
  • Boundaries with people who vampire your energy
  • No large group activities right now. Stay away

All of that is stabilizing. Stabilize yourself and don’t look outside of yourself to get someone or something to do it for you. Your MIND, your BRAIN is a magnet that turns your body into a magnet. It’s literal. The media is trying to program your mind to give your authority and magnetism over to them. Don’t let them in. Our immune systems, bodies, and minds are the province of US and the Universe has our backs. Freedom and balance are universal law. We are supposed to be evolving in freedom and balance otherwise we’ll be programmed to go over the cliff. That gets rid of the weak-minded ones. They obey.

5GForce: Yellow 12 Sun; I dedicate in order to enlighten. Universalizing Life, I seal the matrix of universal fire with the crystal tone of cooperation. I am guided by the power of free will.

SCIENCE STUFF

Yellow 2 Sun Themeplex

  • THEME; Yellow 2 Sun is the Stop Codon
  • ANALOG: Blue 2 Storm or Tryptophan
  • GUIDE POWER; Yellow 2 Human or Glutamic Acid has the extra carbon-hydrogen molecule which humans needed to evolve once we were on the planet
  • HIDDEN WISDOM: Red 12 Cysteine or Red Dragon. Notice the Sulfur molecule in Red Dragon. The Earth began in sulfur and Red Dragon is the first tribe.

Imagine Having a Cosmic Mirror…


This is a real picture of a mirror’s reflection.

Our mediating planet is Neptune. It’s dreamy and visionary. We’re combining that with the Moon in Aries and a creative aspect between Saturn and the Sun. This is serious energy to get some creative work accomplished…finally. However, the Moon squares Jupiter later so we may not have made a concrete decision yet about what direction we’re headed.

The 5GForce is White 1 Wind in synchronicity with our Guide Power and it adds up to 14 which is Occult so there is more being revealed that was hidden today. Be sure to be tuned in, daydream, journal, meditate, create. There is big information afoot to be gleaned.

White Mirror attributes are; Reflection, Order, and Endlessness (Neptune and Saturn!). Mirror is pure, faces the shadow, is self-sacrificing a discriminator, ritualistic, disciplined, has the sword of wisdom, is well coordinated, has clarity, timelessness, and is practical and meditative.

We are looking at 13 Tyrosine in the DNA nucleus of the molecule with 13 Cysteine as it’s analog. As tRNA we see 13 Glycine, as antipode 13 Leucine and as Hidden Wisdom 1 Alanine. It spins to the left in our cells.

SCIENCE CORNER

The hexagon of Saturn is seen there in the Tyrosine molecule so Neptune and Saturn have something symbiotic. Notice the loaded carbon in Leucine which was an essential A.A. in our evolution for the formation of our muscles. And what is the meaning of Alanine and Glycine almost being identical? They are the guide power and Hidden Wisdom today. With the extra Carbon and Hydrogen atom in Alanine, it is indeed magnetizing or grounding our VISIONS from galactic center.

Time Innovation: What is the Binary Triplet Configuration in the Tzolkin?


abstract technology science concept DNA binary on hi tech blue background

The Tzolkin is a 260-day cosmic cycle that syncs precisely with ALL of our solar cycles and events to coordinate manifested time in our matrix as 13:20. It can’t be hacked, and our matrix is holistic and holonomic, not a simulation of a soulless machine world with a selfish male God who has a white beard sitting in a computer room. Our lives aren’t sci-fi. More like bio-non fiction or bio-truth.

The 260-day cycle is divided vertically in half by 2, 13-day cycles that program our two stands of RNA-DNA in every cell of our body. That’s the TWO, or binary part. In addition, there is anion and cation, anode and cathode, positive charge and negative charge that creates an ELM spiral that can and does reverse direction, which is basically a time changer like in Harry Potter. Hermione had one, which is just an archetype for our mental focus, which is what all human talisman are. We are challenged to focus bc of our limbic brain.

Then, the 3 parallels are the N. Polar Zone, The Zone of Transformation, and the S. Polar Zone that are synonymous with the earth, our bodies, and the planets in our local system. That the THREE in triplet. These sections are also split by positive and negative, and it all spirals in a magical dance of collective and I individual MIND, which creates gravity, which creates time and timelessness depending on your focus. In the body, time is on the left and right sides of the body ND brain. But the brain and spine down the center are timelessness, a stargate of illumination and remote viewing, and our connection to eternity.

Thr N. POLAR Zone is 5 lines of 13. The Zone of Transformation is 10 lines of 13. The S. Polar Zo e is 5 lines of 13. The vertical 20-day runs are 13 lines. 20:13 is 260.

You can see the Tzolkin in the image. The matrix overlays the earth multidimensionally and is programmed by our Sun, which is sentient in communication with Galactic Center. That universal program is beyond my pay grade.

                                                    
Jose Arguelles, Author of The Dreamspell and Earth Ascending.

Thursday. White Solar Wizard; Lysine is Evolving but we are in a Conflictual Harmonic in 3D


6.  Sung / Conflict-3D designation only

☰above CH’IEN  /  THE CREATIVE, HEAVEN
☵below K’AN  /  THE ABYSMAL, WATER

Code0-19: 19:14:9:74 (The 19th harmonic, the 14th archetype, the 9th tone and the 74th kin. A full Tzolkonic count would be 65:20:13:260 at the end of a 260 day spin.

The mediating planet today is Malkek or Tiamat which is now the asteroid belt in our solar system. Notice it’s position in relation to The Sun in the center, our little earth and Jupiter.

The attributes afoot for the entire themeplex are; Tone 9 is solar which realizes and pulses intention, that is if the humans corral their minds and FOCUS on setting their intentions for themselves. White Wizard brings enchantment, receptivity and timelessness. They are heart-knowing shamans and concerned with spirituality. Attributes of the other kin are; survival and instinct, love and loyalty, focus and awareness, and healing accomplishment.

In themeplex with White Wizard are Red Serpent, White Dog, Yellow Seed, and Blue Hand which are very grounding for these kin. Their mediating planets are also right next to the asteroid belt and in the image above. Red Serpent is the asteroid best, Yellow Seed is Jupiter, and Blue Hand is the Earth. Indeed, after Maldek blew up the Skywalkers and Worldbridger kin brought the refugees of Maldek to Earth. It wasn’t a far journey. You can find the details of these kin in the app at this link; http://www.another-world.net/MobileSoftware.

SCIENCE CORNER

Here are the rest of the amino acids in themeplex;

Notice that VALINE and ISOLEUCINE are almost identical but isoleucine and valine are ketogenic and glucogenic. They are both BCAA or branched chain amino acids.

This scholarly article gives a more in depth evaluation of the interesting relationship between Valine and Isoleucine.

https://pubmed.ncbi.nlm.nih.gov/24301972/

Sunday. A vision for empowering, commanding, radiant Love, Loyalty, and Heart. White 5 Dog


White 5 Dog; 5 Aspartic Acid

Code0-19: 18:10:5:70

Mediating planet is Mercury which is currently direct.

5GForce; White 9 Dog. Solar, Intention, realization and pulsing of love, loyalty and heart. Get woke!

This is a day for acting and speaking from a flowing open heart that then looks into the mirror guided by clarity, truth, discernment, and commitment. Once that vision is clear from within you, according to your passion and your rational mind, it’s uploaded to Galactic Center Via our Sun.

This it the themeplex today.

I don’t usually use these because I’m not crazy about the art but it does help you see the archetypes and their relationship to one another. The theme is in the center. It’s the nucleus of a DNA molecule. On the right is the analog which is sort of co-equal with the theme and is in the position of the attachment site on the tRNA molecule. Above is the guide power or the D-Arm of the tRNA. On the left is the antipode or the anticodon tRNA on the 3′ and 5′ end of the tRNA. And the hidden wisdom is in the T-arm position. This is my theory. I’m still working on proving it.

The Amino acids analog with these archetypes today are;

  • Aspartic Acid,
  • Methionine, the start codon,
  • Tyrosine, the
  • Stop Codon and
  • Asparagine.

It’s very significant that we have a start and stop codon in the same Tzolkin themeplex. The start and stop codon begin and end the mRNA translation in the sequence. Intuitively, thinking about both the function of the amino acids, their placement, and the attributes of the Tzolkin archetypes, I’d say that the DNA programming of radiant, overtone love from Galactic center is working on flowing and evolving in every nucleus of every DNA cell in every human body today. We need to roll with it, look…in…the…mirror and see ourselves through the eyes of love. Or, see ourselves the way God sees us; as her/his perfect children.

If you are a parent, you know that when your baby is born, they are perfect and you are in love. It was like that for me as a mother and my baby is now 21. I still adore him and want his happiness and health and want him to find the mate he needs and the career he needs to be of service on the planet more than anything else. Now imagine how our Creator feels about us only a bazillion times more. Yes, I see his flaws but forgive them and am patient with them. God’s love IS our love. That’s the only way we have it and it needs to break our hearts open with passion, vision, and forgiveness. We are one human family.

The function of the stop codon, YELLOW SUN, or ZERO is to upload all of that energy like an email to galactic center as a status report. That’s going on right now. From noon-sunset, up it goes. Once we hit dusk it’s Blue 5 Monkey, time to play, relax, hang out until midnight. Happy Sunday.

SCIENCE CORNER

SATURDAY; Red 4 Self-Existing Moon/Water-Methionine


Code0-19: 18:9:4:69

5GForce (Galactic 5th dimensional influence); Blue 10 Planetary Monkey or 10 Asparagine

Mediating planet is Mercury

The order of these in the Tzolkin gateway is Theme; Red Moon, Analog, White Dog, Guide Power, Red Serpent, Antipode, Blue Storm and Hidden Wisdom Yellow Human.

That is 4Methionine, 4Aspartic Acid, 4Serine, 4Tryptophan, and 10Glutamic Acid.

If they are indeed tRNA molecules, and so far my work shows they are an algorithm that programs human genes, they would fit in the tRNA themeplex above only flipped to the right. It’s an amazing synchronicity and I’m still working out the details. The Tzolkin names of the tribes are an archeological fact. In Mayan they are:

  • Imix
  • Ik
  • Akbal
  • Kan
  • Chicchan
  • Cimi
  • Manik
  • Lamat
  • Muluc
  • Oc
  • Chuen
  • Eb
  • Ben
  • Ix
  • Men
  • Cib
  • Caban
  • Etnab
  • Cauac
  • Ahau

The Maya claim to have crash landed on Earth as refugees from Venus. Earth tends to function as a safe port that way. The same thing happened with the blow up of Maldek which is our current, literal asteroid belt. The Malkekians that survived landed in Antarctica. The “people” on this planet tell us that the Venusians are super expert at genetic engineering so they were able to leave this information on the Yucatan Peninsula in their language for successive generations. The modern Maya have done just that. It’s very important for the humans on Earth to knows that we are a mixed species from all over the universe. Our DNA doesn’t originate here but it has most certainly evolved in a beautiful fashion here. Thus, we are at a turning point where we need so save our own skin from extinction. Fortunately we have help.

Friday; Beauty and Art or Ego and Monkey Business?


Code0:19-17:8:3:68

5GForce; Yellow 11 Human. That’s par for this course we’re on. Fifth dimensional DISRUPTIVE, CHAOTIC, DISSOLVING humans. Gee, no shortage of those right now! The mantra for this is;

I dissolve in order to influence. Releasing wisdom I seal the process of freewill with the spectral tone of liberation. I am guided by my own power DOUBLED

The two above are analog today or supportive. The theme is Yellow 3 Star which is activated expansion and other positive actions or emotions. The analog, Blue 3 Monkey is activated illusion and can also be positive and playful if the humans are in the mood. The humans don’t tend to be in the mood right now. The humans are generally very unhappy, especially in my town and in my state of MI. The weather is gorgeous though!

The monkey business happening in many cities in the U.S. right now, is that the police and city officials are just treating everyone, regardless of fact, as though we’re criminals. If you watch violent jungle behavior of chimps there is no difference. They attack the females, kill the children and go after the weaker ones. We ALL share 99% of our DNA with chimpanzees. That’s the Rhesus factor or Rh factor in blood types O, A, B, and AB. If you are negative Rh factor you have no monkey DNA. That said, we ALL have E.T. DNA.

All governments have mistreated citizens and abused their power and position thus we have a situation of millions of citizens contemplating anarchy. I’m not, but if the role of governments doesn’t change I don’t see much reason for their existence. All of that is monkey business. I’m an artist and a healer so frankly, they need to stay out of my way and not waste my time.

Synchronous with all of this energy is a lunar eclipse in Gemini and the full moon today in Sagittarius. We are in a period of enhanced communication instead of conflict and greater movement and expansion.

SCIENCE CORNER

This is a potent amino acid set up again with Glutamine-Q or Red Skywalker front and center. Red Skywalker is Yellow Star Hidden Wisdom so they are always next to each other, forever and ever. Glutamine is dynamically mixing with Asparagine-N and Glutamic Acid today, meaning Blue Monkey and Yellow Human. As I write this, I’m running a ton of energy thinking about humans and monkeys and how violent they get when oppressed. So, good luck with that. The best policy is to avoid large groups of humans, anywhere. They could snap right now and already have.

Friday; Red 9 Solar Dragon is Breathing Fire


I’m sorry I didn’t post yesterday but the Dragon was coming out of it’s lair during the Hidden Wisdom, dusk to Midnight and I was kind of on the run. Last night was Red 6 Dragon so issues of equality and manipulation of Mind were on the front burner. The day was good but when the sun went down the energy turned.

I don’t watch T.V. but seeing the Twitter feed was enough to let me know that tumultuous Tone 6 was wreaking havoc with people’s minds who are easy pickin’s meaning reactive. I was also busy deleting every last one of my pictures on Facebook and I’ll be deleting my account soon. It’s a very bad platform, very bad energy, and puts humans in a fake mind and time bubble. It adds to the time warp. I’ve noticed some followers are afraid to go off-FBWorld and come into the internet universe to get my posts. That’s amazing mind control right there. They’re also afraid of Twitter so this media programming is real and people isolate themselves. FB is Disneyland.

I watch no T.V. at all and get the news from the ethers and meditate instead. If you do watch it you don’t have a chance in heaven of getting away unscathed. It’s important right now to have a few degrees of separation during the last days of Caligula coming to an end here so you can focus your own mind instead of having it programmed for you. There has to be an end to this thing!

So we pulsed right off of Red 6 Dragon last night into the fire of Red 9 Solar Dragon today with an analog of White 9 Solar Mirror (Tyrosine). That fire is breathed right onto OUR REFLECTION. Who do we see in the mirror??? We’re all humans and ONE human race. All human lives matter equally.

Our mediating planet today is Neptune and it’s currently in Aquarius. Aquarius is all about shaking up the status quo and rebelling. This is a pretty interesting 5 Amino Acid (Tzolkin archetype) themeplex as we factor in the dynamic between the analog, White 9 Mirror (Tyrosine) and the Guide Power, Red 9 Earth (Phenylalanine) which is solar synchronicity. Add to that Tone 9 is solar and the hidden wisdom affecting the subconscious mind is The Sun or Yellow 5 Sun (The Stop Codon that ends the sequencing on the mRNA Strand of the RNA) which is overtone and radiant.

Before I nutshell this, lets look at the 5th dimensional GForce to get a true perspective. If you just look at things from 3D ground level it’s not a correct angle to assess what’s really going on. The GForce today is Blue 5 Storm. It makes perfect sense. The overtone 5 is commanding, radiant and empowering. People in America are ripping the freaking mask off their faces, UNMUZZLING themselves and expressing how they feel. It’s just where some people’s brains are stationed. I’m a peaceful person but I accept that many aren’t there yet nor do I expect them to be. They obey whether they agree or not and then remain quiet until it erupts. None of that is healthy nor is it what the Tzolkin calls for in the interest of human evolution. It’s just what is happening and humans are known to want their freedom and throw a fit at INJUSTICE and CONTROL! There’s plenty of that around to be sure. That said, they aren’t always focused on what they DO want and throw a fit about what they don’t want. Blue 5 Storm is the perfect energy to shore up catalyzing the truth, potent energy and self-generation.

“I empower in order to catalyze. Commanding energy I seal the matrix of self-generation with the overtone tone of radiance. I am guided by the power of accomplishment. I am a galactic activation portal. Enter me.”-The Dreamspell

The Nutshell

These amino acids evolving in multidimensional existence are shaking up the planet to come into a new phase of focused physical power and a brain ability to have less fear about the unknown and create something other than chaos which tends to be Blue Monkey energy. Those that are at the very bottom of development are getting used by the takers very easily. They’ve followed the institutions all of their lives. They’ve made some poor choices with regard to following the crowd and reacting to media. Tone 6 tends to be all about that. But when you make a poor choice, the next time you might see a better choice and go that route. Live and learn. The Tzolkin is forever telling us that we are on a SELF-GENERATING (Tone 4 and everything about Earth is FOUR) Planet. Were not called to wait around for other people to agree with us or expect it so this thought-form is dying off.

Synchronicity; What is your Birth Gateway?



Anyone who wants to input their full birthday into the Tzolkin Day Calculator, just go to the site at the link below. At the top is a rectangle. Click on the rectangle on this page that says “Dreamspell Calculator.”

Tzolkin Day Calculator

Scroll down the page until you see where you input your birthday.
Your Tzolkin Themeplex will then pop up. Now, go back to the first page. Find the name of your archetype on the huge list, click on that, and there is much great reading about your multi-dimensional self.

There are also a few apps you can add to your phone. Just search online.

If you’re interested in a full chart you can order it. Just email me. They take me about two hours to do and the fee is $100.00.

I will add it to the shop page soon.