Deciphering the Genetic Code


The Chinese Hexagrams

The DNA nucleotide were first deciphered by the Chinese. Around the year 1050 BCE, tradition states that Emperor Wen, founder of the Zhou dynasty, created hexagrams. He did this by doubling the trigrams. These hexagrams are six-lined figures. He numbered and arranged all of the possible combinations. There are 64, and he gave them names.

They did this in the manner that they interpret life. As my followers know, this discovery was turned into the IChing hexagrams thousands of years before 1961. The Chinese created 64 hexagrams that stood for Life first. They accomplished this long before Western white men worked in the lab in white coats during the 60’s. Western scientists took these hexagrams and ascribed triplet letters to them. Two lines of the hexagram represented one letter: A, C, G, T, or U for the RNA. Before the scientists did that, Leibniz turned the hexagrams into binary code or 0’s and 1’s.

So the time spiral goes; The Chinese made significant contributions first by designing and giving meaning to the Hexagrams. The production of stelae by the Maya had its origin around 400 BC and continued through to the end of the Classic Period, around 900, although some monuments were reused in the Postclassic (c. 900–1521).Then Leibniz developed his binary code by looking at the Chinese symbols as lines and dashes or 0 and 1. Next was the Turing machine, hypothetical computing device introduced in 1936 by the English mathematician and logician Alan M. Turing. This was the predecessor of the computer which added the electronic element to the interpretation of our DNA. Then Rosalind Franklin photographed the DNA double helix, but her work was unacknowledged. Then Watson and Crick introduced their DNA model in 1953. Rosalind Franklin and her student Raymond Gosling had photographed it in 1952. But Watson and Crick got all the credit. Now we arrive at Marshall Nirenberg and his colleagues in the 60’s in this article. They were at the National Institutes of Health and interpreted the language of the genetic code.

Before you read his, know this. The Maya, the Chinese, and Rosalind Franklin gave the world the genetic code in its original intended form. It has since been obfuscated by white coat men in the labs of universities and at the National level. I hope to bring it back around to its original, expanded meaning, lost since the Maya. Such is the nature of Oracles in a technologically dominated world.

The link to this article.

https://www.acs.org/education/whatischemistry/landmarks/geneticcode.html

National Historic Chemical Landmark

Dedicated November 12, 2009, at the National Institutes of Health in Bethesda, Maryland.

Commemorative Booklet (PDF)

DNA consists of a code language comprising four letters. These letters make up what are known as codons, or words. Each codon is three letters long. Marshall Nirenberg and his colleagues at the National Institutes of Health interpreted the language of the genetic code. It was their collaborative work that achieved this. Their careful work, conducted in the 1960s, paved the way for interpreting the sequences of the entire human genome.

Contents

Modern Genetics: A Monk and a Double Helix

Modern genetics begins with an obscure Augustinian monk studying the inheritance of various traits in pea plants. Gregor Mendel’s laws of inheritance revealed the probabilities of dominant and recessive traits being passed from generation to generation. Mendel’s research received little recognition in his lifetime. The significance of Mendel’s laws was recognized only in the early 20th century.

With that rediscovery came interest in how genetic information is transmitted. Oswald Avery, a bacteriologist at New York’s Rockefeller Institute, demonstrated that deoxyribonucleic acid, DNA, produced inheritable changes. This discovery was not well received. How could DNA store genetic information? It was a substance containing only four different nucleotide building blocks. Others discovered that DNA varies from species to species. Then, in 1953, James Watson and Francis Crick at Cambridge University amazed the scientific world. They introduced their model of DNA, known as the double helix. Watson and Crick recognized that the double strand might allow replication.

How could DNA, a double helix made up of only four different nucleotide, determine the composition of enzymes (proteins)? These enzymes are long peptide chains composed of twenty different amino acids. The race to discover the genetic code which translates DNA’s information into proteins was underway. To stimulate the chase, George Gamow, a theoretical physicist, organized the twenty-member “RNA Tie Club.” Each member wore a tie with the symbol for one of the 20 amino acids. The members shared ideas on how DNA transmitted information.

The scientist who won the race was not a member of the “club.”

Deciphering the Genetic Code commemorative booklet

The “Deciphering the Genetic Code” is a commemorative booklet. It was produced by the National Historic Chemical Landmarks program of the American Chemical Society. The booklet was published in 2009 (PDF).

I thought if I’m going to work this hard, I might just as well have fun. By fun, I mean I wanted to explore an important problem. I wanted to discover things.”
— Interview with Marshall Nirenberg, July 15, 2009.

Marshall Nirenberg’s Early Career

Marshall Nirenberg earned a Ph.D. in biological chemistry. He studied at the University of Michigan. His dissertation focused on the mechanism of sugar uptake in tumor cells. He continued that research as a postdoctoral fellow at the National Institutes of Health. In 1959, he joined the staff of NIH as a research biochemist.

Nirenberg gave some thought to what he wanted to study as an independent investigator. He said in 2009, “At that time, the mechanism of protein synthesis was very incompletely known.” Messenger RNA had not been discovered.

Nirenberg’s initial goal was to find out if DNA or RNA, copied from DNA, was the template for protein synthesis. Nirenberg had no formal training in molecular genetics. He knew that this was an incredibly risky project. When you take your first position, you want to hit the deck running. You want to show you are a productive scientist. Nirenberg had no experience in the field. He had no staff at the outset and was in a race against the best scientists. He knew he “could fail easily.”

*This and subsequent quotations, unless the text indicates differently, are from an interview by Judah Ginsberg and Marshall Nirenberg, conducted in his laboratory on the campus of NIH on July 15, 2009.

Experiments with Synthetic RNA

Nirenberg and Heinrich Matthaei started their experiments by studying DNA and RNA. Matthaei, a postdoctoral fellow from Germany, collaborated on the research. In DNA, the nucleotide are adenine (A), guanine (G), cytosine (C) and thymine (T); in RNA, uracil (U), replaces thymine.

They chose a cell-free environment, created when cell walls are broken down, releasing the cell’s contents. The remaining cytoplasm can still synthesize protein when RNA is added. This allows the researchers to design experiments. They can determine how RNA works free of the complicated biological processes that could shroud molecular activity.

Nirenberg and Matthaei selected E. coli bacteria cells as their source of cytoplasm. They added the E. coli extract to 20 test tubes, each containing a mixture of all 20 amino acids. In each test tube one amino acid was radioactively tagged, a different one in each test tube. The reaction could be followed by monitoring radioactivity: incorporation of a “hot” amino acid would form a “hot” protein.

Breaking the Genetic Code: The “poly-U” Experiment

At 3:00 in the morning on May 27, 1961, Matthaei begins his experiment. (Yellow 13 Seed which hits in 3 days) He adds synthetic RNA. It was a Saturday. The RNA is made only of uracil units. He adds it to each of the 20 test tubes. He finds unusual activity in one of the tubes. This tube contains Phenylalanine. The test results are spectacular. A chain of uracil units in the “hot” tube directs the addition of the “hot” amino acid.

Nirenberg and Matthaei understood what had happened. Synthetic RNA made of a chain of multiple units of uracil gave instructions. It directed a chain of amino acids to add Phenylalanine. The uracil chain (poly-U) served as a messenger directing protein synthesis. The question of how many units of U were required was yet unanswered. However, the experiment proved that messenger RNA transcribes genetic information. It transcribes this information from DNA. It directs the assembly of amino acids into complex proteins. The key to breaking the genetic code—molecular biology’s Rosetta Stone—had been discovered.

Nirenberg presented his successful poly-U experiment at an international biochemistry congress held in Moscow in August, a few months later. He was acutely aware of his outsider status. He said, “I didn’t know the people in molecular biology. I didn’t know anybody in protein synthesis. I was working on my own.” That may explain why only 35 people attended his talk and why the audience “was absolutely dead.”

Nirenberg experienced a serendipitous event that changed everything. He had met Watson the day before. Nirenberg told the co-discoverer of the double helix about his results. Watson was skeptical about Nirenberg’s claims. However, he convinced a colleague to attend the paper. The colleague reported that Nirenberg’s findings were real. Watson then told Crick, who arranged for Nirenberg to present his paper again. This time, it was in a major symposium on nucleic acids at the same congress. “The reaction was incredible,” Nirenberg remembered. “When it was over, the audience gave a standing ovation. I didn’t know it at that moment. For the next five years, I became like a scientific rock star.”

Marshall Nirenberg performing an experiment, circa 1962.

Courtesy the National Institutes of Health.

Nirenberg and Matthaei “cracked” the first “word” of the genetic code. Afterward, scientists raced to translate the unique code words for each amino acid. They hoped to someday read the entire genetic code of living organisms. Nirenberg assembled a team of about twenty researchers and technicians.

Nirenberg and his colleagues used the poly-U experiment as a model. They identified nucleotide combinations for the incorporation of other amino acids. The researchers found that the coding units for amino acids contain three nucleotide (a triplet). They combined four nucleotide in three-letter codes. This combination yielded 64 possible combinations (4 x 4 x 4). This was sufficient to describe 20 amino acids.

They discovered the codes for other amino acids: for example, AAA for Lysine and CCC for Proline. Replacing one unit of a triplet code with another nucleotide yielded a different amino acid. For instance, synthetic RNA containing one unit of guanine and two of uracil (code word: GUU) caused incorporation of Valine.

In 1964 Nirenberg and Philip Leder discovered a method. Leder was a postdoctoral fellow at NIH. They determined the sequence of the letters in each triplet word for amino acids. By 1966 Nirenberg had deciphered the 64 RNA three-letter code words (codons) for all 20 amino acids. The language of DNA was now understood and the code could be expressed in a chart.

The Nobel Prize and Reactions

In 1968 Nirenberg won the Nobel Prize in Physiology or Medicine for his seminal work on the genetic code. He shared the award with Har Gobind Khorana (University of Wisconsin). Khorana mastered the synthesis of nucleic acids. Robert Holley (Cornell University) also shared the award. Holley discovered the chemical structure of transfer-RNA. Collectively, the three were recognized “for their interpretation of the genetic code and its function in protein synthesis.”

Nirenberg describes the ceremonies surrounding the Nobel as “a week of parties.” Not quite all parties, however, since the rules of the Nobel require recipients to write a review article. This proved a challenge for Nirenberg, who had turned his research attention to neurobiology. ”I found it very difficult,” he later admitted, “to break off from neurobiology and go back to nucleic acids.”

As a Nobel Laureate, Nirenberg received many university offers that included higher salary, more laboratory space, and larger staff. He turned them all down, preferring to spend the rest of his career at NIH. “The reason I stayed,” he says, “was because the thing I had least of was time. I figured that if I went to a university, I would use a third of my time to write grants. I believed I could use that time more productively by doing experiments.”

In 1961 The New York Times, echoing President Kennedy, reported about Nirenberg’s research. It showed that biology “has reached a new frontier.” One journalist suggested the biggest news story of the year was not Russian cosmonaut Yuri Gagarin orbiting the earth. Instead, the biggest story was the cracking of the genetic code.

Deciphering the genetic code raised ethical concerns about the potential for genetic engineering. Nirenberg addressed these concerns in a famous editorial in Science in August 1967. He noted “that man may be able to program his own cells.” This could happen before “he has sufficient wisdom to use this knowledge for the benefit of mankind.” He emphasized that “decisions concerning the application of this knowledge must be made by society.” Only an informed society can make such decisions wisely. When asked several decades later if society has acted “wisely” regarding genetic engineering, Nirenberg answered, “Absolutely!”

HOW THE DNA DOUBLE HELIX FACTORY WORKS


This is literally an ancient, microbiological factory.

  • An RNA template strand comes out of it. Each rung of the ladder is called a base pair and there are about 3 billion base pairs that make up the genome, 30,000 genes and each cell have 23 pair of chromosomes. They thread around a spool as in torsion.
  • Transcription factors bind open DNA and can recruit other proteins such as enzymes.
  • RNA polymerase; DNA reads and transcribes DNA into RNA.
  • The single strand RNA copies the A, C, T, and G of the mRNA
  • It carries it out of the nucleus to the ribosome for the production of the particular protein that this gene codes for.
  • There can be millions of ribosomes in a typical eukaryotic cell
  • These complex cells use the RNA copy of the gene for info. to assemble amino acid building blocks into the 3D proteins that are essential for life. The ribosome is composed of one large and one small subunit that assembles around the mRNA which then passes through the ribosome like a computer tape.
  • The amino acid building blocks are carried into the ribosome attached to SPECIFIC transfer RNA. They are attached to the glob of tRNA.
  • The small subunit of the ribosome positions the mRNA so that it can be READ in groups of 3 letters known as a codon.
  • Each codon on the mRNA matches a corresponding anticodon on the base of a transfer RNA molecule.
  • The larger subunit of the ribosome removes each AA and joins it onto the glowing protein chain.
  • As the mRNA is ratcheted through the ribosome the mRNA sequence is translated into an AA sequence (the Tzolkin themeplexes)
  • There are 3 locations inside the ribosome designated A, P, and E site
  • The addition of each AA is a 3-step cycle.
  • #1. RNA enters the ribosome at the A site and is tested for a codon, anticodon, match with the mRNA
  • #2. If there is a match the tRNA is shifted to the P site and the AA it carries is added to the end of the AA chain.
  • The mRNA is also stuck on 3 nucleotides or 1 codon.
  • #3-the spent tRNA is moved to the E site and then ejected from the ribosome to be recycled.
  • 6 feet of DNA fits in the nucleus of every cell of an organism.
  • In the helicase, it’s copied backward. It moves as fast as a jet engine looping and coiling leading to chromosomes.
  • Then comes the KINETICORE. It’s a crazy, universal operation with its microtubule fibers.
  • Chromatin is called the tightly packed cell
  • Then it’s a chromatid
  • Then it’s a chromosome
  • Then it’s a nuclear pore and has a nuclear membrane gateway in the cell. The membrane breaks down.

Understanding DNA’s Double Helix: A Detailed Guide


One rendering of the Chinese I Ching Oracle that is the source of our DNA Nucleotides and Binary Code

HOW THE DNA DOUBLE HELIX WORKS

  • An RNA template strand comes out of it. Each rung of the ladder is called a base pair. There are about 3 billion base pairs that make up the genome. There are 30,000 genes. Each cell has 23 pairs of chromosomes. They thread around a spool as in torsion.
  • Transcription factors bind open DNA and can recruit other proteins such as enzymes.
  • RNA polymerase; DNA reads and transcribes DNA into RNA.
  • The single strand RNA copies the A, C, T, and G (Adenine, Cytosine, Thymine, Guanine and Uracil; the nucleotides) of the mRNA
  • It carries it out of the nucleus to the ribosome. This is for the production of the particular protein that this gene codes for.
  • There can be millions of ribosomes in a typical eukaryotic cell
  • These complex cells use the RNA copy of the gene for info. to assemble amino acid building blocks into the 3D proteins that are essential for life. The ribosome has two subunits, one large and one small. These subunits assemble around the mRNA. The mRNA then passes through the ribosome like a computer tape.
  • The amino acid building blocks are carried into the ribosome attached to SPECIFIC transfer RNA. They are attached to the glob of tRNA.
  • The small subunit of the ribosome positions the mRNA. It enables the mRNA to be read in groups of 3 letters. These groups are known as a codon.
  • Each codon on the mRNA matches a corresponding anticodon on the base of a transfer RNA molecule.
  • The larger subunit of the ribosome removes each AA and joins it onto the glowing protein chain.
  • As the mRNA is ratcheted through the ribosome the mRNA sequence is translated into an AA sequence (the Tzolkin themeplexes)
  • There are 3 locations inside the ribosome designated A, P, and E site
  • The addition of each AA is a 3-step cycle.
  • #1. RNA enters the ribosome at the A site and is tested for a codon, anticodon, match with the mRNA
  • #2. If there is a match, the tRNA moves to the P site. The AA it carries is added to the end of the AA chain.
  • The mRNA is also stuck on 3 nucleotides or 1 codon.
  • #3-the spent tRNA is moved to the E site and then ejected from the ribosome to be recycled.
  • 6 feet of DNA fits in the nucleus of every cell of an organism.
  • In the helicase, it’s copied backward. It moves as fast as a jet engine looping and coiling leading to chromosomes.
  • The comes the KINETICORE. It’s a crazy, universal operation with its microtubule fibers.
  • Chromatin is called the tightly packed cell
  • Then it’s a chromatid
  • Then it’s a chromosome
  • Then it’s a nuclear pore and has a nuclear membrane gateway in the cell. The membrane breaks down.

Clear as mud? I just thought the 3D facts should be recorded here even though the synchronicity of it is magical.

Plasma tech merging with our RNA?


Humans are 55% plasma and 45% blood. Whoa. The sun is plasma, so we are 55% a little sun made of stardust. And we need the sun to keep our plasma dominant. I have never… heard anyone say this. Most people don’t even know what plasma is.

I’m saying it.

Four States of Matter

Gas, liquid, solid… PLASMA. Humans are all of those, but plasma is considered unstable because the electrons are flying wildly around the DNA nucleus like lightning. That sounds like fun to me. That is how humans are, too.

Plasma is a comprehensive conduit as a state of matter to merge evolving RNA with our tools. Both RNA and plasma are unstable, wild, and evolving. The scientists hate it. I love it, but I’m not a control freak. Firm with boundaries for the wild children, yes, but freedom always.

It works perfectly with humans because we are 98% evolving RNA. In addition, we are made of mostly H2O, mostly hydrogen, which is the most abundant neutral gas in the universe. It’s electrically conductive because we have ELM in us. We wouldn’t be charged if water didn’t conduct ELM. We’re made of stardust, which would be plasma dust. The sun is plasma, hydrogen, and helium. Our blood is part plasma and hemoglobin.

The magnetosphere is plasma, and so is the sun or at least raw solar wind. Can AI merge with plasma? Idk. It could get dangerous.

Plasma is the most abundant form of ordinary matter in the universe, mostly in stars (including the Sun), but also dominates the rarefied intracluster medium and intergalactic medium. Plasma can be artificially generated, for example, by heating a neutral gas such as hydrogen or subjecting it to a strong electromagnetic field.

But most people don’t even know what plasma is. It’s never talked about.

https://en.m.wikipedia.org/wiki/Plasma_(physics)

Tesla was the first person to produce RF (radio frequency) plasmas

https://www.researchgate.net/publication/270465075_The_Contribution_of_Nikola_Tesla_to_Plasma_Physics_and_Current_Status_of_Plasmas_that_He_Studied

When the frequency of an applied field lies in the range of radio waves, only the electrons can follow the electric field, whereas the ions remain at rest. These electrons collide with the gas atoms/molecules and ionize them to generate plasma. Such plasma sources are called RF plasma sources.

https://www.impedans.com/rf-power-sources

Humans as a Power Source

At rest, the human body generates an average of 100 watts of output. During sports activities, it reaches 300 to 400 watts. That’s the equivalent of burning 2,000 calories a day. Or, from a different perspective, the energy used by an LED floodlight over a 24-hour period.-Aug 29, 2023

Human Power Plant – Freudenberg Sealing Technologies

Our red blood cells, white blood cells, and platelets make up about 45% of the volume of our blood. The remaining 55% is liquid plasma.

I’ll stop there so your  brain doesn’t explode. I love this stuff and just keep going. 😆

The Reverse, Backward Movement of the Harmonic in the Psi Bank


What you see above are 8 Tzolk’in Harmonics, 4 facing up, 4 facing down but diagonal from each other. Look at the ones on the bottom. Red 1 Dragon, kin#1 is in the bottom right. If you turned it right side up it would look just like the top harmonics. This shows how they are processed through the Psi bank like computer code. This is from Earth Ascending page 149.

It’s a type of mirroring in synchronicity with today’s theme; White 11 Spectral Mirror. I started on this idea yesterday wondering about what was really happening with mRNA reverse transcriptase that Bruce Lipton was talking about in his video that I posted a few days ago. Listen to it again. He says that the DNA Dogma taught that the DNA only moved in one direction. That’s not the case once you understand mRNA reverse transcriptase and that speaks DIRECTLY to Tzolkonic Movement and current epigenetic claims of being able to program your own DNA by going backward. Or, as I’m suggesting in my book based on research, past to present or future to present AS TIME IN YOUR BODY/MIND. Nobody knows that yet but me and my followers. Earth Ascending was written in 1984 before anyone understood Epigenetics.

You can see the backward movement in this image. The bottom four harmonics are upside down. That’s a #20 along the left side and #13 across the top; 20 tribes of time or 20 A.A. and 13 Tones of Creation.

I’m studying this in alignment with three locations on the ribosome of the double helix that is added to the A.A. sequence: A site, P site, and E site. Once the RNA picks a site it’s copied into the helicase BACKWARD as fast as a jet plane. It’s shown in a couple videos I have, and I’ve posted it on here before. The scientists have seen the actual movement, but they don’t know what causes it…of course.

Then it goes to the mysterious Kinetochore where eventually it’s turned into a chromosome and then a nuclear pore with a nuclear membrane that breaks apart. I’ve watched the process several times.

Back to the ribosome, it comes from the mRNA (messenger RNA which is being utilized by the CV2 vaccine makers to program our RNA with God knows what. The mRNA moves like a computer program through the ribosome, through a few more steps, until it’s turned into tRNA or transfer RNA.

What are the three types of mRNA?

  • mRNA (messenger RNA): Produced during transcription.
  • rRNA (ribosomal RNA): Together with proteins, composes the ribosome, the organelles that are the site of protein synthesis.
  • tRNA (transfer RNA): Brings the correct amino acid to the ribosome during translation.

Once again, it seems to me the Tzolkin Harmonic Theme-plex is the tRNA that brings the correct amino acid to the ribosome during translation. Of course, all of this is dynamic evolution though and is never the same so that’s where the patterns I’ve observed come in such as the occult partner (your mother’s DNA) and the alpha and omega point placement. It’s not simple. In addition, the function of the G.A. P. kin is epic. That’s in the book as well.

I hate to tell the scientists this but none of it can be controlled. 98% of evolution is beyond any human or stellar species control. People experiment with it but I for one am not convinced that’s terribly wise. It depends on what they’re doing. Natural evolution is not the same, by far, as genetic experimentation on different species.

My point is the reverse transcriptase happens through the mRNA whose action is in synchronicity with the movement of the harmonic in the Psi Bank.

Blueprint for Life: Scientists Detect All Bases of DNA and RNA in Meteorites | Nature World News


Not all amino acid’s are glycoproteins of which humans and other animals consist. The bases of glycoproteins are found in meteorites.

https://www.natureworldnews.com/articles/50570/20220427/blueprint-life-scientists-detect-bases-dna-rna-meteorites.htm

91 Research Studies Affirm Naturally Acquired Immunity to Covid-19: Documented, Linked, and Quoted


Our evolving human RNA responding to any virus is more than adequate to protect us through an illness if we take care of ourselves in basic ways.

Lisa T.

BY PAUL ELIAS ALEXANDER   OCTOBER 17, 2021   PUBLIC HEALTH   40 MINUTE READSHARE | PRINT | EMAILFacebookTwitterRedditLinkedInFlipboardTelegramPrintEmailShare

We should not force COVID vaccines on anyone when the evidence shows that naturally acquired immunity is equal to or more robust and superior to existing vaccines. Instead, we should respect the right of the bodily integrity of individuals to decide for themselves. 

Public health officials and the medical establishment with the help of the politicized media are misleading the public with assertions that the COVID-19 shots provide greater protection than natural immunity.  CDC Director Rochelle Walensky, for example, was deceptive in her October 2020 published LANCET statement that “there is no evidence for lasting protective immunity to SARS-CoV-2 following natural infection” and that “the consequence of waning immunity would present a risk to vulnerable populations for the indefinite future.” 

Immunology and virology 101 have taught us over a century that natural immunity confers protection against a respiratory virus’s outer coat proteins, and not just one, e.g. the SARS-CoV-2 spike glycoprotein. There is even strong evidence for the persistence of antibodies. Even the CDC recognizes natural immunity for chicken-pox and measles, mumps, and rubella, but not for COVID-19. 

The vaccinated are showing viral loads (very high) similar to the unvaccinated (Acharya et al. and Riemersma et al.), and the vaccinated are as infectious. Riemersma et al. also report Wisconsin data that corroborate how the vaccinated individuals who get infected with the Delta variant can potentially (and are) transmit(ting) SARS-CoV-2 to others (potentially to the vaccinated and unvaccinated). 

This troubling situation of the vaccinated being infectious and transmitting the virus emerged in seminal nosocomial outbreak papers by Chau et al. (HCWs in Vietnam), the Finland hospital outbreak (spread among HCWs and patients), and the Israel hospital outbreak (spread among HCWs and patients). These studies also revealed that the PPE and masks were essentially ineffective in the healthcare setting.⁹ Again, the Marek’s disease in chickens and the vaccination situation explains what we are potentially facing with these leaky vaccines (increased transmission, faster transmission, and more ‘hotter’ variants). 

Moreover, existing immunity should be assessed before any vaccination, via an accurate, dependable, and reliable antibody test (or T cell immunity test) or be based on documentation of prior infection (a previous positive PCR or antigen test). Such would be evidence of immunity that is equal to that of vaccination and the immunity should be provided the same societal status as any vaccine-induced immunity. This will function to mitigate the societal anxiety with these forced vaccine mandates and societal upheaval due to job loss, denial of societal privileges etc. Tearing apart the vaccinated and the unvaccinated in a society, separating them, is not medically or scientifically supportable. 

The Brownstone Institute previously documented 30 studies on natural immunity as it relates to Covid-19. 

This follow-up chart is the most updated and comprehensive library list of 91 of the highest-quality, complete, most robust scientific studies and evidence reports/position statements on natural immunity as compared to the COVID-19 vaccine-induced immunity and allow you to draw your own conclusion.

I’ve benefited from the input of many to put this together, especially my co-authors:

  • Dr. Harvey Risch, MD, PhD (Yale School of Public Health) 
  • Dr. Howard Tenenbaum, PhD ( Faculty of Medicine, University of Toronto)
  • Dr. Ramin Oskoui, MD (Foxhall Cardiology, Washington)
  • Dr. Peter McCullough, MD (Truth for Health Foundation (TFH)), Texas
  • Dr. Parvez Dara, MD (consultant, Medical Hematologist and Oncologist)


Evidence on natural immunity versus COVID-19 vaccine induced immunity as of October 15th 2021:

Study / report title, author, and year publishedPredominant finding on natural immunity1) Necessity of COVID-19 vaccination in previously infected individuals, Shrestha, 2021“Cumulative incidence of COVID-19 was examined among 52,238 employees in an American healthcare system.

The cumulative incidence of SARS-CoV-2 infection remained almost zero among previously infected unvaccinated subjects, previously infected subjects who were vaccinated, and previously uninfected subjects who were vaccinated, compared with a steady increase in cumulative incidence among previously uninfected subjects who remained unvaccinated. Not one of the 1359 previously infected subjects who remained unvaccinated had a SARS-CoV-2 infection over the duration of the study. 

Individuals who have had SARS-CoV-2 infection are unlikely to benefit from COVID-19 vaccination…”2) SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls, Le Bert, 2020“Studied T cell responses against the structural (nucleocapsid (N) protein) and non-structural (NSP7 and NSP13 of ORF1) regions of SARS-CoV-2 in individuals convalescing from coronavirus disease 2019 (COVID-19) (n = 36). In all of these individuals, we found CD4 and CD8 T cells that recognized multiple regions of the N protein…showed that patients (n = 23) who recovered from SARS possess long-lasting memory T cells that are reactive to the N protein of SARS-CoV 17 years after the outbreak of SARS in 2003; these T cells displayed robust cross-reactivity to the N protein of SARS-CoV-2.”3) Comparing SARS-CoV-2 natural immunity to vaccine-induced immunity: reinfections versus breakthrough infections,Gazit, 2021“A retrospective observational study comparing three groups: (1) SARS-CoV-2-naïve individuals who received a two-dose regimen of the BioNTech/Pfizer mRNA BNT162b2 vaccine, (2) previously infected individuals who have not been vaccinated, and (3) previously infected and single dose vaccinated individuals found para a 13 fold increased risk of breakthrough Delta infections in double vaccinated persons, and a 27 fold increased risk for symptomatic breakthrough infection in the double vaccinated relative to the natural immunity recovered persons…the risk of hospitalization was 8 times higher in the double vaccinated (para)…this analysis demonstrated that natural immunity affords longer lasting and stronger protection against infection, symptomatic disease and hospitalization due to the Delta variant of SARS-CoV-2, compared to the BNT162b2 two-dose vaccine-induced immunity.”4) Highly functional virus-specific cellular immune response in asymptomatic SARS-CoV-2 infection, Le Bert, 2021“Studied SARS-CoV-2–specific T cells in a cohort of asymptomatic (n = 85) and symptomatic (n = 75) COVID-19 patients after seroconversion…thus, asymptomatic SARS-CoV-2–infected individuals are not characterized by weak antiviral immunity; on the contrary, they mount a highly functional virus-specific cellular immune response.”5) Large-scale study of antibody titer decay following BNT162b2 mRNA vaccine or SARS-CoV-2 infection, Israel, 2021“A total of 2,653 individuals fully vaccinated by two doses of vaccine during the study period and 4,361 convalescent patients were included. Higher SARS-CoV-2 IgG antibody titers were observed in vaccinated individuals (median 1581 AU/mL IQR [533.8-5644.6]) after the second vaccination, than in convalescent individuals (median 355.3 AU/mL IQR [141.2-998.7]; p<0.001). In vaccinated subjects, antibody titers decreased by up to 40% each subsequent month while in convalescents they decreased by less than 5% per month…this study demonstrates individuals who received the Pfizer-BioNTech mRNA vaccine have different kinetics of antibody levels compared to patients who had been infected with the SARS-CoV-2 virus, with higher initial levels but a much faster exponential decrease in the first group”.6) SARS-CoV-2 re-infection risk in Austria, Pilz, 2021Researchers recorded “40 tentative re-infections in 14, 840 COVID-19 survivors of the first wave (0.27%) and 253 581 infections in 8, 885, 640 individuals of the remaining general population (2.85%) translating into an odds ratio (95% confidence interval) of 0.09 (0.07 to 0.13)…relatively low re-infection rate of SARS-CoV-2 in Austria. Protection against SARS-CoV-2 after natural infection is comparable with the highest available estimates on vaccine efficacies.” Additionally, hospitalization in only five out of 14,840 (0.03%) people and death in one out of 14,840 (0.01%) (tentative re-infection).7) mRNA vaccine-induced SARS-CoV-2-specific T cells recognize B.1.1.7 and B.1.351 variants but differ in longevity and homing properties depending on prior infection status, Neidleman, 2021“Spike-specific T cells from convalescent vaccinees differed strikingly from those of infection-naïve vaccinees, with phenotypic features suggesting superior long-term persistence and ability to home to the respiratory tract including the nasopharynx. These results provide reassurance that vaccine-elicited T cells respond robustly to the B.1.1.7 and B.1.351 variants, confirm that convalescents may not need a second vaccine dose.”8) Good news: Mild COVID-19 induces lasting antibody protection, Bhandari, 2021“Months after recovering from mild cases of COVID-19, people still have immune cells in their body pumping out antibodies against the virus that causes COVID-19, according to a study from researchers at Washington University School of Medicine in St. Louis. Such cells could persist for a lifetime, churning out antibodies all the while. The findings, published May 24 in the journal Nature, suggest that mild cases of COVID-19 leave those infected with lasting antibody protection and that repeated bouts of illness are likely to be uncommon.”9) Robust neutralizing antibodies to SARS-CoV-2 infection persist for months, Wajnberg, 2021“Neutralizing antibody titers against the SARS-CoV-2 spike protein persisted for at least 5 months after infection. Although continued monitoring of this cohort will be needed to confirm the longevity and potency of this response, these preliminary results suggest that the chance of reinfection may be lower than is currently feared.”10) Evolution of Antibody Immunity to SARS-CoV-2, Gaebler, 2020“Concurrently, neutralizing activity in plasma decreases by five-fold in pseudo-type virus assays. In contrast, the number of RBD-specific memory B cells is unchanged. Memory B cells display clonal turnover after 6.2 months, and the antibodies they express have greater somatic hypermutation, increased potency and resistance to RBD mutations, indicative of continued evolution of the humoral response…we conclude that the memory B cell response to SARS-CoV-2 evolves between 1.3 and 6.2 months after infection in a manner that is consistent with antigen persistence.”11) Persistence of neutralizing antibodies a year after SARS-CoV-2 infection in humans, Haveri, 2021“Assessed the persistence of serum antibodies following WT SARS-CoV-2 infection at 8 and 13 months after diagnosis in 367 individuals…found that NAb against the WT virus persisted in 89% and S-IgG in 97% of subjects for at least 13 months after infection.”12) Quantifying the risk of SARS‐CoV‐2 reinfection over time, Murchu, 2021“Eleven large cohort studies were identified that estimated the risk of SARS‐CoV‐2 reinfection over time, including three that enrolled healthcare workers and two that enrolled residents and staff of elderly care homes. Across studies, the total number of PCR‐positive or antibody‐positive participants at baseline was 615,777, and the maximum duration of follow‐up was more than 10 months in three studies. Reinfection was an uncommon event (absolute rate 0%–1.1%), with no study reporting an increase in the risk of reinfection over time.”13) Natural immunity to covid is powerful. Policymakers seem afraid to say so, Makary, 2021Makary writes “it’s okay to have an incorrect scientific hypothesis. But when new data proves it wrong, you have to adapt. Unfortunately, many elected leaders and public health officials have held on far too long to the hypothesis that natural immunity offers unreliable protection against covid-19 — a contention that is being rapidly debunked by science. More than 15 studies have demonstrated the power of immunity acquired by previously having the virus. A 700,000-person study from Israel two weeks ago found that those who had experienced prior infections were 27 times less likely to get a second symptomatic covid infection than those who were vaccinated. This affirmed a June Cleveland Clinic study of health-care workers (who are often exposed to the virus), in which none who had previously tested positive for the coronavirus got reinfected. The study authors concluded that “individuals who have had SARS-CoV-2 infection are unlikely to benefit from covid-19 vaccination.” And in May, a Washington University study found that even a mild covid infection resulted in long-lasting immunity.”14) SARS-CoV-2 elicits robust adaptive immune responses regardless of disease severity, Nielsen, 2021“203 recovered SARS-CoV-2 infected patients in Denmark between April 3rd and July 9th 2020, at least 14 days after COVID-19 symptom recovery… report broad serological profiles within the cohort, detecting antibody binding to other human coronaviruses… the viral surface spike protein was identified as the dominant target for both neutralizing antibodies and CD8+ T-cell responses. Overall, the majority of patients had robust adaptive immune responses, regardless of their disease severity.”15) Protection of previous SARS-CoV-2 infection is similar to that of BNT162b2 vaccine protection: A three-month nationwide experience from Israel, Goldberg, 2021“Analyze an updated individual-level database of the entire population of Israel to assess the protection efficacy of both prior infection and vaccination in preventing subsequent SARS-CoV-2 infection, hospitalization with COVID-19, severe disease, and death due to COVID-19… vaccination was highly effective with overall estimated efficacy for documented infection of 92·8% (CI:[92·6, 93·0]); hospitalization 94·2% (CI:[93·6, 94·7]); severe illness 94·4% (CI:[93·6, 95·0]); and death 93·7% (CI:[92·5, 94·7]). Similarly, the overall estimated level of protection from prior SARS-CoV-2 infection for documented infection is 94·8% (CI: [94·4, 95·1]); hospitalization 94·1% (CI: [91·9, 95·7]); and severe illness 96·4% (CI: [92·5, 98·3])…results question the need to vaccinate previously-infected individuals.”16) Incidence of Severe Acute Respiratory Syndrome Coronavirus-2 infection among previously infected or vaccinated employees, Kojima, 2021“Employees were divided into three groups: (1) SARS-CoV-2 naïve and unvaccinated, (2) previous SARS-CoV-2 infection, and (3) vaccinated. Person-days were measured from the date of the employee first test and truncated at the end of the observation period. SARS-CoV-2 infection was defined as two positive SARS-CoV-2 PCR tests in a 30-day period… 4313, 254 and 739 employee records for groups 1, 2, and 3…previous SARS-CoV-2 infection and vaccination for SARS-CoV-2 were associated with decreased risk for infection or re-infection with SARS-CoV-2 in a routinely screened workforce. The was no difference in the infection incidence between vaccinated individuals and individuals with previous infection.” 17) Having SARS-CoV-2 once confers much greater immunity than a vaccine—but vaccination remains vital, Wadman, 2021“Israelis who had an infection were more protected against the Delta coronavirus variant than those who had an already highly effective COVID-19 vaccine…the newly released data show people who once had a SARS-CoV-2 infection were much less likely than never-infected, vaccinated people to get Delta, develop symptoms from it, or become hospitalized with serious COVID-19.”18) One-year sustained cellular and humoral immunities of COVID-19 convalescents, Zhang, 2021“A systematic antigen-specific immune evaluation in 101 COVID-19 convalescents; SARS-CoV-2-specific IgG antibodies, and also NAb can persist among over 95% COVID-19 convalescents from 6 months to 12 months after disease onset. At least 19/71 (26%) of COVID-19 convalescents (double positive in ELISA and MCLIA) had detectable circulating IgM antibody against SARS-CoV-2 at 12m post-disease onset. Notably, the percentages of convalescents with positive SARS-CoV-2-specific T-cell responses (at least one of the SARS-CoV-2 antigen S1, S2, M and N protein) were 71/76 (93%) and 67/73 (92%) at 6m and 12m, respectively.” 19) Functional SARS-CoV-2-Specific Immune Memory Persists after Mild COVID-19, Rodda, 2021“Recovered individuals developed SARS-CoV-2-specific immunoglobulin (IgG) antibodies, neutralizing plasma, and memory B and memory T cells that persisted for at least 3 months. Our data further reveal that SARS-CoV-2-specific IgG memory B cells increased over time. Additionally, SARS-CoV-2-specific memory lymphocytes exhibited characteristics associated with potent antiviral function: memory T cells secreted cytokines and expanded upon antigen re-encounter, whereas memory B cells expressed receptors capable of neutralizing virus when expressed as monoclonal antibodies. Therefore, mild COVID-19 elicits memory lymphocytes that persist and display functional hallmarks of antiviral immunity.”20) Discrete Immune Response Signature to SARS-CoV-2 mRNA Vaccination Versus Infection, Ivanova, 2021“Performed multimodal single-cell sequencing on peripheral blood of patients with acute COVID-19 and healthy volunteers before and after receiving the SARS-CoV-2 BNT162b2 mRNA vaccine to compare the immune responses elicited by the virus and by this vaccine…both infection and vaccination induced robust innate and adaptive immune responses, our analysis revealed significant qualitative differences between the two types of immune challenges. In COVID-19 patients, immune responses were characterized by a highly augmented interferon response which was largely absent in vaccine recipients. Increased interferon signaling likely contributed to the observed dramatic upregulation of cytotoxic genes in the peripheral T cells and innate-like lymphocytes in patients but not in immunized subjects. Analysis of B and T cell receptor repertoires revealed that while the majority of clonal B and T cells in COVID-19 patients were effector cells, in vaccine recipients clonally expanded cells were primarily circulating memory cells…we observed the presence of cytotoxic CD4 T cells in COVID-19 patients that were largely absent in healthy volunteers following immunization. While hyper-activation of inflammatory responses and cytotoxic cells may contribute to immunopathology in severe illness, in mild and moderate disease, these features are indicative of protective immune responses and resolution of infection.”21) SARS-CoV-2 infection induces long-lived bone marrow plasma cells in humans, Turner, 2021“Bone marrow plasma cells (BMPCs) are a persistent and essential source of protective antibodies… durable serum antibody titres are maintained by long-lived plasma cells—non-replicating, antigen-specific plasma cells that are detected in the bone marrow long after the clearance of the antigen … S-binding BMPCs are quiescent, which suggests that they are part of a stable compartment. Consistently, circulating resting memory B cells directed against SARS-CoV-2 S were detected in the convalescent individuals. Overall, our results indicate that mild infection with SARS-CoV-2 induces robust antigen-specific, long-lived humoral immune memory in humans…overall, our data provide strong evidence that SARS-CoV-2 infection in humans robustly establishes the two arms of humoral immune memory: long-lived bone marrow plasma cells (BMPCs) and memory B-cells.”22) SARS-CoV-2 infection rates of antibody-positive compared with antibody-negative health-care workers in England: a large, multicentre, prospective cohort study (SIREN), Jane Hall, 2021“The SARS-CoV-2 Immunity and Reinfection Evaluation study… 30 625 participants were enrolled into the study… a previous history of SARS-CoV-2 infection was associated with an 84% lower risk of infection, with median protective effect observed 7 months following primary infection. This time period is the minimum probable effect because seroconversions were not included. This study shows that previous infection with SARS-CoV-2 induces effective immunity to future infections in most individuals.”23) Pandemic peak SARS-CoV-2 infection and seroconversion rates in London frontline health-care workers, Houlihan, 2020“Enrolled 200 patient-facing HCWs between March 26 and April 8, 2020…represents a 13% infection rate (i.e. 14 of 112 HCWs) within the 1 month of follow-up in those with no evidence of antibodies or viral shedding at enrolment. By contrast, of 33 HCWs who tested positive by serology but tested negative by RT-PCR at enrolment, 32 remained negative by RT-PCR through follow-up, and one tested positive by RT-PCR on days 8 and 13 after enrolment.”24) Antibodies to SARS-CoV-2 are associated with protection against reinfection, Lumley, 2021“Critical to understand whether infection with Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) protects from subsequent reinfection… 12219 HCWs participated…prior SARS-CoV-2 infection that generated antibody responses offered protection from reinfection for most people in the six months following infection.”25) Longitudinal analysis shows durable and broad immune memory after SARS-CoV-2 infection with persisting antibody responses and memory B and T cells, Cohen, 2021“Evaluate 254 COVID-19 patients longitudinally up to 8 months and find durable broad-based immune responses. SARS-CoV-2 spike binding and neutralizing antibodies exhibit a bi-phasic decay with an extended half-life of >200 days suggesting the generation of longer-lived plasma cells… most recovered COVID-19 patients mount broad, durable immunity after infection, spike IgG+ memory B cells increase and persist post-infection, durable polyfunctional CD4 and CD8 T cells recognize distinct viral epitope regions.”26) Single cell profiling of T and B cell repertoires following SARS-CoV-2 mRNA vaccine, Sureshchandra, 2021“Used single-cell RNA sequencing and functional assays to compare humoral and cellular responses to two doses of mRNA vaccine with responses observed in convalescent individuals with asymptomatic disease… natural infection induced expansion of larger CD8 T cell clones occupied distinct clusters, likely due to the recognition of a broader set of viral epitopes presented by the virus not seen in the mRNA vaccine.”27) SARS-CoV-2 antibody-positivity protects against reinfection for at least seven months with 95% efficacy, Abu-Raddad, 2021“SARS-CoV-2 antibody-positive persons from April 16 to December 31, 2020 with a PCR-positive swab ≥14 days after the first-positive antibody test were investigated for evidence of reinfection, 43,044 antibody-positive persons who were followed for a median of 16.3 weeks…reinfection is rare in the young and international population of Qatar. Natural infection appears to elicit strong protection against reinfection with an efficacy ~95% for at least seven months.”28) Orthogonal SARS-CoV-2 Serological Assays Enable Surveillance of Low-Prevalence Communities and Reveal Durable Humoral Immunity, Ripperger, 2020“Conducted a serological study to define correlates of immunity against SARS-CoV-2. Compared to those with mild coronavirus disease 2019 (COVID-19) cases, individuals with severe disease exhibited elevated virus-neutralizing titers and antibodies against the nucleocapsid (N) and the receptor binding domain (RBD) of the spike protein…neutralizing and spike-specific antibody production persists for at least 5–7 months… nucleocapsid antibodies frequently become undetectable by 5–7 months.”29) Anti-spike antibody response to natural SARS-CoV-2 infection in the general population, Wei, 2021“In the general population using representative data from 7,256 United Kingdom COVID-19 infection survey participants who had positive swab SARS-CoV-2 PCR tests from 26-April-2020 to 14-June-2021…we estimated antibody levels associated with protection against reinfection likely last 1.5-2 years on average, with levels associated with protection from severe infection present for several years. These estimates could inform planning for vaccination booster strategies.”30) Antibody Status and Incidence of SARS-CoV-2 Infection in Health Care Workers, Lumley, 2021“12,541 health care workers participated and had anti-spike IgG measured; 11,364 were followed up after negative antibody results and 1265 after positive results, including 88 in whom seroconversion occurred during follow-up…a total of 223 anti-spike–seronegative health care workers had a positive PCR test (1.09 per 10,000 days at risk), 100 during screening while they were asymptomatic and 123 while symptomatic, whereas 2 anti-spike–seropositive health care workers had a positive PCR test… the presence of anti-spike or anti-nucleocapsid IgG antibodies was associated with a substantially reduced risk of SARS-CoV-2 reinfection in the ensuing 6 months.”31) Researchers find long-lived immunity to 1918 pandemic virus, CIDRAP, 2008
and the actual 2008 NATURE journal publication by Yu“A study of the blood of older people who survived the 1918 influenza pandemic reveals that antibodies to the strain have lasted a lifetime and can perhaps be engineered to protect future generations against similar strains…the group collected blood samples from 32 pandemic survivors aged 91 to 101..the people recruited for the study were 2 to 12 years old in 1918 and many recalled sick family members in their households, which suggests they were directly exposed to the virus, the authors report. The group found that 100% of the subjects had serum-neutralizing activity against the 1918 virus and 94% showed serologic reactivity to the 1918 hemagglutinin. The investigators generated B lymphoblastic cell lines from the peripheral blood mononuclear cells of eight subjects. Transformed cells from the blood of 7 of the 8 donors yielded secreting antibodies that bound the 1918 hemagglutinin.” Yu: “here we show that of the 32 individuals tested that were born in or before 1915, each showed sero-reactivity with the 1918 virus, nearly 90 years after the pandemic. Seven of the eight donor samples tested had circulating B cells that secreted antibodies that bound the 1918 HA. We isolated B cells from subjects and generated five monoclonal antibodies that showed potent neutralizing activity against 1918 virus from three separate donors. These antibodies also cross-reacted with the genetically similar HA of a 1930 swine H1N1 influenza strain.”32) Live virus neutralisation testing in convalescent patients and subjects vaccinated against 19A, 20B, 20I/501Y.V1 and 20H/501Y.V2 isolates of SARS-CoV-2, Gonzalez, 2021“No significant difference was observed between the 20B and 19A isolates for HCWs with mild COVID-19 and critical patients. However, a significant decrease in neutralisation ability was found for 20I/501Y.V1 in comparison with 19A isolate for critical patients and HCWs 6-months post infection. Concerning 20H/501Y.V2, all populations had a significant reduction in neutralising antibody titres in comparison with the 19A isolate. Interestingly, a significant difference in neutralisation capacity was observed for vaccinated HCWs between the two variants whereas it was not significant for the convalescent groups…the reduced neutralising response observed towards the 20H/501Y.V2 in comparison with the 19A and 20I/501Y.V1 isolates in fully immunized subjects with the BNT162b2 vaccine is a striking finding of the study.”33) Differential effects of the second SARS-CoV-2 mRNA vaccine dose on T cell immunity in naïve and COVID-19 recovered individuals, Camara, 2021“Characterized SARS-CoV-2 spike-specific humoral and cellular immunity in naïve and previously infected individuals during full BNT162b2 vaccination…results demonstrate that the second dose increases both the humoral and cellular immunity in naïve individuals. On the contrary, the second BNT162b2 vaccine dose results in a reduction of cellular immunity in COVID-19 recovered individuals.”

34) Op-Ed: Quit Ignoring Natural COVID Immunity, Klausner, 2021“Epidemiologists estimate over 160 million people worldwide have recovered from COVID-19. Those who have recovered have an astonishingly low frequency of repeat infection, disease, or death.”35) Association of SARS-CoV-2 Seropositive Antibody Test With Risk of Future Infection, Harvey, 2021“To evaluate evidence of SARS-CoV-2 infection based on diagnostic nucleic acid amplification test (NAAT) among patients with positive vs negative test results for antibodies in an observational descriptive cohort study of clinical laboratory and linked claims data…the cohort included 3 257 478 unique patients with an index antibody test…patients with positive antibody test results were initially more likely to have positive NAAT results, consistent with prolonged RNA shedding, but became markedly less likely to have positive NAAT results over time, suggesting that seropositivity is associated with protection from infection.”36) SARS-CoV-2 seropositivity and subsequent infection risk in healthy young adults: a prospective cohort study, Letizia, 2021“Investigated the risk of subsequent SARS-CoV-2 infection among young adults (CHARM marine study) seropositive for a previous infection…enrolled 3249 participants, of whom 3168 (98%) continued into the 2-week quarantine period. 3076 (95%) participants…Among 189 seropositive participants, 19 (10%) had at least one positive PCR test for SARS-CoV-2 during the 6-week follow-up (1·1 cases per person-year). In contrast, 1079 (48%) of 2247 seronegative participants tested positive (6·2 cases per person-year). The incidence rate ratio was 0·18 (95% CI 0·11–0·28; p<0·001)…infected seropositive participants had viral loads that were about 10-times lower than those of infected seronegative participants (ORF1ab gene cycle threshold difference 3·95 [95% CI 1·23–6·67]; p=0·004).” 37) Associations of Vaccination and of Prior Infection With Positive PCR Test Results for SARS-CoV-2 in Airline Passengers Arriving in Qatar, Bertollini, 2021“Of 9,180 individuals with no record of vaccination but with a record of prior infection at least 90 days before the PCR test (group 3), 7694 could be matched to individuals with no record of vaccination or prior infection (group 2), among whom PCR positivity was 1.01% (95% CI, 0.80%-1.26%) and 3.81% (95% CI, 3.39%-4.26%), respectively. The relative risk for PCR positivity was 0.22 (95% CI, 0.17-0.28) for vaccinated individuals and 0.26 (95% CI, 0.21-0.34) for individuals with prior infection compared with no record of vaccination or prior infection.”38) Natural immunity against COVID-19 significantly reduces the risk of reinfection: findings from a cohort of sero-survey participants, Mishra, 2021“Followed up with a subsample of our previous sero-survey participants to assess whether natural immunity against SARS-CoV-2 was associated with a reduced risk of re-infection (India)… out of the 2238 participants, 1170 were sero-positive and 1068 were sero-negative for antibody against COVID-19. Our survey found that only 3 individuals in the sero-positive group got infected with COVID-19 whereas 127 individuals reported contracting the infection the sero-negative group…from the 3 sero-positives re-infected with COVID-19, one had hospitalization, but did not require oxygen support or critical care…development of antibody following natural infection not only protects against re-infection by the virus to a great extent, but also safeguards against progression to severe COVID-19 disease.”39) Lasting immunity found after recovery from COVID-19, NIH, 2021“The researchers found durable immune responses in the majority of people studied. Antibodies against the spike protein of SARS-CoV-2, which the virus uses to get inside cells, were found in 98% of participants one month after symptom onset. As seen in previous studies, the number of antibodies ranged widely between individuals. But, promisingly, their levels remained fairly stable over time, declining only modestly at 6 to 8 months after infection… virus-specific B cells increased over time. People had more memory B cells six months after symptom onset than at one month afterwards… levels of T cells for the virus also remained high after infection. Six months after symptom onset, 92% of participants had CD4+ T cells that recognized the virus… 95% of the people had at least 3 out of 5 immune-system components that could recognize SARS-CoV-2 up to 8 months after infection.”  40) SARS-CoV-2 Natural Antibody Response Persists for at Least 12 Months in a Nationwide Study From the Faroe Islands, Petersen, 2021“The seropositive rate in the convalescent individuals was above 95% at all sa

Watch “Ancient Aliens: Ancient Alien DNA (Season 10) | History” on YouTube


Sunday; Blue 10 Planetary Monkey; Analog Yellow 10 Star. We can change our own DNA by Receiving Downloads Via The Sun.


RED 4 SELF-EXISTING MOON is our 5GForce. It is METHIONINE or the START CODON.

We’re already into the antipode for the day which is Red 10 Planetary Dragon. The Guide Power from dawn to noon was Blue 10 Planetary Storm and it has been super stormy in Michigan.

With Red Dragon we move into some memories of our mothers, our ancestors, our feelings about that, nurturing and Being. Don’t hesitate to make this upcoming Thanksgiving and Solstice extra special since this is a CAPSTONE, a PINNACLE, the top of the mountain as far as our evolution and balancing for the planet. It’s not comfy and easy but it is getting better. We are getting more and more disclosure and RECKONING between right and wrong, dark and light spirituality.

We also have the opportunity and ability to do DIRECT DOWNLOADS from the sun for new RNA sequences to balance our own damaged DNA issues so that we can slowly come into our LIGHT BODIES as the EARTH comes into HER LIGHT BODY.

It just happened to me with my left leg. I had been working on it myself for months doing deep manual therapy and Reiki, I lay on my bed in the direct, hot sun last Wednesday and automatically received a crazy download like a computer software program of numbers and symbols really fast INTO MY CLOSED EYES. I just relaxed knowing that I was being helped or given information from our ancestors. I know how to receive information I don’t understand and not try to analyze it. Then I went about my day.

That night I felt lightly virusy and got the chills and ran a fever of 100 degrees +, no biggie, but I felt sick. Then my left leg that had been crushed (the soft tissue) 47 years ago, where I had been working on dense scar tissue, got very red and felt very strange. I couldn’t walk on it for three days. I knew from looking at it that the BLOOD finally released like a damn into my old injured ankle and foot. When blood circulation is blocked in injured tissue the tissue cannot heal. That tissue has to be released but of course sick care industry has no clue and never pays attention to the flesh medically. I very gently worked on it and it was getting better quickly. How was this old injury related to what I interpreted as a virus?

It was not “an illness” which is what we think of as “a virus” I was told. The only way these RNA packets can explode in our earth bodies is if they turn on or challenge the IMMUNE SYSTEM with a certain amount of stress. Just bc your immune system is challenged doesn’t mean you are literally sick. True sickness is when you sit in a very negative mind and heart set over time and cause DIS EASE or UN EASE in your soul. Then you get very sick. I had asked and wished, multiple times for that lower leg to be the way it used to be so I would no longer have neuropathy in that foot! It would keep me up at night.

It’s gone now folks. My foot is normal. The ankle is almost normal. The leg is already. The download was a mental RNA packet coming into this dimension as a challenge to my immune system to uptake the new sequence. We have to allow this or we won’t evolve upward. Some entities on this planet would prefer that. I don’t prefer it. That then mutates my own DNA and makes it what it was before in that leg. EVERY MOLECULE OF OUR BODY HAS DNA. Every molecule of our body exists and has existed IN TIME. OUR SUN REGULATES ALL OF IT AND HAS THE CODES THAT EACH OF US NEEDS. There are two suns; the sun we see and the sun that is hidden which is directly tied to Galactic Center. There is no limit in time or space (physical holographic projection in our world) of what is possible. It’s up to OUR MINDS TO FOCUS and CHOOSE what we want. Now it’s time to do it. We can do it and I’m giving you the HEADS UP!

I desperately want my BODY in THIS TIME AND DIMENSION to be WHOLE AND AGELESS. I’m going to have it because I have plenty to do on this planet before I take off. Dare you to try it.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Sunday. A vision for empowering, commanding, radiant Love, Loyalty, and Heart. White 5 Dog


White 5 Dog; 5 Aspartic Acid

Code0-19: 18:10:5:70

Mediating planet is Mercury which is currently direct.

5GForce; White 9 Dog. Solar, Intention, realization and pulsing of love, loyalty and heart. Get woke!

This is a day for acting and speaking from a flowing open heart that then looks into the mirror guided by clarity, truth, discernment, and commitment. Once that vision is clear from within you, according to your passion and your rational mind, it’s uploaded to Galactic Center Via our Sun.

This it the themeplex today.

I don’t usually use these because I’m not crazy about the art but it does help you see the archetypes and their relationship to one another. The theme is in the center. It’s the nucleus of a DNA molecule. On the right is the analog which is sort of co-equal with the theme and is in the position of the attachment site on the tRNA molecule. Above is the guide power or the D-Arm of the tRNA. On the left is the antipode or the anticodon tRNA on the 3′ and 5′ end of the tRNA. And the hidden wisdom is in the T-arm position. This is my theory. I’m still working on proving it.

The Amino acids analog with these archetypes today are;

  • Aspartic Acid,
  • Methionine, the start codon,
  • Tyrosine, the
  • Stop Codon and
  • Asparagine.

It’s very significant that we have a start and stop codon in the same Tzolkin themeplex. The start and stop codon begin and end the mRNA translation in the sequence. Intuitively, thinking about both the function of the amino acids, their placement, and the attributes of the Tzolkin archetypes, I’d say that the DNA programming of radiant, overtone love from Galactic center is working on flowing and evolving in every nucleus of every DNA cell in every human body today. We need to roll with it, look…in…the…mirror and see ourselves through the eyes of love. Or, see ourselves the way God sees us; as her/his perfect children.

If you are a parent, you know that when your baby is born, they are perfect and you are in love. It was like that for me as a mother and my baby is now 21. I still adore him and want his happiness and health and want him to find the mate he needs and the career he needs to be of service on the planet more than anything else. Now imagine how our Creator feels about us only a bazillion times more. Yes, I see his flaws but forgive them and am patient with them. God’s love IS our love. That’s the only way we have it and it needs to break our hearts open with passion, vision, and forgiveness. We are one human family.

The function of the stop codon, YELLOW SUN, or ZERO is to upload all of that energy like an email to galactic center as a status report. That’s going on right now. From noon-sunset, up it goes. Once we hit dusk it’s Blue 5 Monkey, time to play, relax, hang out until midnight. Happy Sunday.

SCIENCE CORNER