Time Innovation: HUMAN DNA IS A BIOLOGICAL INTERNET and superior in many aspects to the artificial one


I didn’t write this so it’s free-Lisa T.

All information is taken from the book “Vernetzte Intelligenz” von Grazyna Fosar und Franz Bludorf, ISBN 3930243237, summarized and commented on by Baerbel. The book is unfortunately only available in German so far. You can reach the authors here: www.fosar-bludorf.com

Transmitted by Vitae Bergman [ www.ryze.com/view.php?who=vitaeb ]

Russian scientific research directly or indirectly explains phenomena such as clairvoyance, intuition, spontaneous and remote acts of healing, self-healing, affirmation techniques, unusual light/auras around people (namely spiritual masters), mind’s influence on weather patterns and much more. In addition, there is evidence for a whole new type of medicine in which DNA can be influenced and reprogrammed by words and frequencies WITHOUT cutting out and replacing single genes.

Only 10% of our DNA is being used for building proteins. It is this subset of DNA that is of interest to western researchers and is being examined and categorized. The other 90% are considered “junk DNA.” The Russian researchers, however, convinced that nature was not dumb, joined linguists and geneticists in a venture to explore those 90% of “junk DNA.” Their results, findings and conclusions are simply revolutionary!

According to them, our DNA is not only responsible for the construction of our body but also serves as data storage and in communication. The Russian linguists found that the genetic code, especially in the apparently useless 90%, follows the same rules as all our human languages. To this end they compared the rules of syntax (the way in which words are put together to form phrases and sentences), semantics (the study of meaning in language forms) and the basic rules of grammar. They found that the alkaline of our DNA follows regular grammar and do have set rules just like our languages. So, human languages did not appear coincidentally but reflected our inherent DNA.

The Russian biophysicist and molecular biologist Pjotr Garjajev and his colleagues also explored the vibrational behavior of the DNA. [For the sake of brevity, I will give only a summary here. For further exploration please refer to the appendix at the end of this article.] The bottom line was:

“Living chromosomes function just like solitonic/holographic computers using the endogenous DNA laser radiation.”

This means that they managed, for example, to modulate certain frequency patterns onto a laser ray and with it influenced the DNA frequency and thus the genetic information itself. Since the basic structure of DNA-alkaline pairs and of language (as explained earlier) are of the same structure, no DNA decoding is necessary.

One can simply use words and sentences of the human language! This, too, was experimentally proven! Living DNA substances (in living tissue, not in vitro) will always react to language-modulated laser rays and even to radio waves if the proper frequencies are being used.

This finally and scientifically explains why affirmations, autogenous training, hypnosis, and the like can have such strong effects on humans and their bodies. It is entirely normal and natural for our DNA to react to language. While western researchers cut single genes from the DNA strands and insert them elsewhere, the Russians enthusiastically worked on devices that can influence the cellular metabolism through suitable modulated radio and light frequencies and thus repair genetic defects.

Garjajev’s research group succeeded in proving that with this method chromosomes damaged by x-rays for example can be repaired. They even captured information patterns of a particular DNA and transmitted it onto another, thus reprogramming cells to another genome. So, they successfully transformed, for example, frog embryos to salamander embryos simply by transmitting the DNA information patterns! This way the entire information was transmitted without any of the side effects or disharmonies encountered when cutting out and re-introducing single genes from the DNA.

This represents an unbelievable, world-transforming revolution and sensation! All this by simply applying vibration and language instead of the archaic cutting-slash and burn procedure! This experiment points to the immense power of wave genetics, which obviously has a greater influence on the formation of organisms than the biochemical processes of alkaline sequences.

Esoteric and spiritual teachers have known for ages that our body is programmable by language, words and thought. This has now been scientifically proven and explained. Of course, the frequency must be correct. And this is why not all are equally successful or can always do it with the same strength. The individual person must work on the inner processes and maturity to establish a conscious communication with the DNA. The Russian researchers work on a method that is not dependent on these factors but will ALWAYS work, provided one uses the correct frequency.

BlackLine (1K)

Qout (1K)   Kryon has now given us a full channeled explanation of this, and brings it right into the quantum world. Is it possible that DNA is mostly quantum instructions? And if so, what’s in those instructions that comprise over 2.7 billion chemicals per strand?

Here is a full revelation of the twelve layers, or energies of DNA, complete with full color channeled illustrations of each layer by Israeli/American artist Elan Dubro-Cohen. Could it be that our entire Akashic record is carried in our DNA? What else might be represented? It starts to make sense, and the most recent discoveries of quantum physics only enhances the potentials of this quantum molecule.

The Twelve Layers of DNA (Kryon Book 12) (Kryon, Volume 12)
Lee Carroll (Author), Elan Dubro-Cohen (Illustrator)

But the higher developed an individual’s consciousness is, the less need there is for any type of device! One can achieve these results by oneself, and science will finally stop to laugh at such ideas and will confirm and explain the results. And it doesn’t end there. The Russian scientists also found out that our DNA can cause disturbing patterns in the vacuum, thus producing magnetized wormholes! Wormholes are the microscopic equivalents of the so-called Einstein-Rosen bridges in the vicinity of black holes (left by burned-out stars).? These are tunnel connections between entirely different areas in the universe through which information can be transmitted outside of space and time. DNA attracts these bits of information and passes them on to our consciousness. This process of hyper communication is most effective in a state of relaxation. Stress worries or a hyperactive intellect prevent successful hyper communication, or the information will be totally distorted and useless.

In nature, hyper communication has been successfully applied for millions of years. The organized flow of life in insect states proves this dramatically. Modern man knows it only on a much more subtle level as “intuition.” But we, too, can regain full use of it. An example from Nature: When a queen ant is spatially separated from her colony, building continues fervently and according to plan. If the queen is killed, however, all work in the colony stops. No ant knows what to do. Apparently, the queen sends the “building plans” also from far away via the group consciousness of her subjects. She can be as far away as she wants if she is alive. In man hyper communication is most often encountered when one suddenly gains access to information that is outside one’s knowledge base. Such hyper communication is then experienced as inspiration or intuition. The Italian composer Giuseppe Tartini for instance dreamt one night that a devil sat at his bedside playing the violin. The next morning Tartini was able to note down the piece exactly from memory, he called it the Devil’s Trill Sonata.

For years, a 42-year-old male nurse dreamt of a situation in which he was hooked up to a kind of knowledge CD-ROM. Verifiable knowledge from all imaginable fields was then transmitted to him that he was able to recall in the morning. There was such a flood of information that it seemed a whole encyclopedia was transmitted at night. Many facts were outside his personal knowledge base and reached technical details about which he knew absolutely nothing.

When hyper communication occurs, one can observe in the DNA as well as in the human being special phenomena. The Russian scientists irradiated DNA samples with laser light. On screen a typical wave pattern was formed. When they removed the DNA sample, the wave pattern did not disappear, it remained. Many control experiments showed that the pattern still came from the removed sample, whose energy field apparently remained by itself. This effect is now called the phantom DNA effect. It is surmised that energy from outside of space and time still flows through the activated wormholes after the DNA was removed. The side effects encountered most often in hyper communication also in human beings are inexplicable electromagnetic fields in the vicinity of the persons concerned. Electronic devices like CD players and the like can be irritating and cease to function for hours. When the electromagnetic field slowly dissipates, the devices function normally again. Many healers and psychics know this effect from their work. The better the atmosphere and the energy, the more frustrating it is that the recording device stops functioning and recording exactly at that moment. And repeated switching on and off after the session does not restore function yet, but next morning all is back to normal. Perhaps this is reassuring to read for many, as it has nothing to do with them being technically inept, it means they are good at hyper communication.

In their book “Vernetzte Intelligenz” (Networked Intelligence), Grazyna Gosar and Franz Bludorf explain these connections precisely and clearly. The authors also quote sources presuming that in earlier times humanity had been, just like the animals, very strongly connected to the group consciousness and acted as a group. To develop and experience individuality we humans, however, had to forget hyper communication almost completely. Now that we are stable in our individual consciousness, we can create a new form of group consciousness, namely one, in which we attain access to all information via our DNA without being forced or remotely controlled about what to do with that information. We now know that just as on the internet our DNA can feed its proper data into the network, can call up data from the network and can establish contact with other participants in the network. Remote healing, telepathy or “remote sensing” about the state of relatives etc. can thus be explained. Some animals also know from afar when their owners plan to return home. That can be freshly interpreted and explained via the concepts of group consciousness and hyper communication. Any collective consciousness cannot be sensibly used over any period without a distinctive individuality. Otherwise, we would revert to a primitive herd instinct that is easily manipulated.

Hyper communication in the new millennium means something quite different: Researchers think that if humans with full individuality would regain group consciousness, they would have a god-like power to create, alter and shape things on Earth! AND humanity is collectively moving toward such a group consciousness of the new kind. Fifty percent of today’s children will be problem children as soon as they go to school. The system lumps everyone together and demands adjustment. But the individuality of today’s children is so strong that that they refuse this adjustment and give up their idiosyncrasies in the most diverse ways.

At the same time more and more clairvoyant children are born [see the book “China’s Indigo Children” by Paul Dong or the chapter about Indigos in my book “Nutze die taeglichen Wunder” (Make Use of the Daily Wonders)]. Something in those children is striving more and more towards the group consciousness of the new kind, and it will no longer be suppressed. As a rule, weather for example is rather difficult to influence by a single individual. But it may be influenced by a group consciousness (nothing new to some tribes doing it in their rain dances). Weather is strongly influenced by Earth resonance frequencies, the so-called Schumann frequencies. But those same frequencies are also produced in our brains, and when many people synchronize their thinking or individuals (spiritual masters, for instance) focus their thoughts on a laser-like fashion, then it is scientifically speaking not at all surprising if they can thus influence weather.

Researchers in group consciousness have formulated the theory of Type I civilizations. A humanity that developed a group consciousness of the new kind would have neither environmental problems nor scarcity of energy. For if it were to use its mental power as a unified civilization, it would have control of the energies of its home planet as a natural consequence. And that includes all natural catastrophes!!! A theoretical Type II civilization would even be able to control all energies of their home galaxy. In my book “Nutze die taeglichen Wunder,” I have described an example of this: Whenever a great many people focus their attention or consciousness on something similar like Christmas time, football world championship or the funeral of Lady Diana in England then certain random number generators in computers start to deliver ordered numbers instead of the random ones. An ordered group consciousness creates order in its whole surroundings!

When a great number of people get together very closely, the potential of violence also dissolve. It looks as if here, too, a kind of humanitarian consciousness of all humanity is created.(The Global Consciousness Project)

BlackLine (1K)

Qout (1K)   What do the so-called sacred sites all over the world have to do with consciousness? Is it possible that the ancients left us keys to who we really are and what we are capable of? What does sacred geometry really have to do with these sites, our consciousness and even the symbology of world religions? How does all of this tie together to literally solve the meaning of the Mayan Calendar?

The Secret History of Consciousness: Ancient Keys to Our Future Survival
Meg Blackburn Losey Ph.D. (Author)

To come back to DNA: It apparently is also an organic superconductor that can work at normal body temperature. Artificial superconductors require extremely low temperatures of between 200 and 140°C to function. As one recently learned, all superconductors can store light and thus information. This is a further explanation of how DNA can store information. There is another phenomenon linked to DNA and wormholes. Normally, these super-small wormholes are highly unstable and are maintained only for the tiniest fractions of a second. Under certain conditions stable wormholes can organize themselves which then form distinctive vacuum domains in which for example gravity can transform into electricity.

Vacuum domains are self-radiant balls of ionized gas that contain considerable amounts of energy. There are regions in Russia where such radiant balls appear very often. Following the ensuing confusion, the Russians started massive research programs leading finally to some of the discoveries mentions above. Many people know vacuum domains as shiny balls in the sky. Attentive look at them in wonder and ask themselves what they could be. I thought once: “Hello up there. If you happen to be a UFO, fly in a triangle.” And suddenly, the light balls moved in a triangle. Or they shot across the sky like ice hockey pucks. They accelerated from zero to crazy speeds while sliding gently across the sky. One is left gawking and I have, like many others, too, thought them to be UFOs. Friendly ones, apparently, as they flew in triangles just to please me. Now the Russians found in the regions, where vacuum domains appear often that sometimes fly as balls of light from the ground upwards into the sky, that these balls can be guided by thought. One has found out since that vacuum domains emit waves of low frequency as they are also produced in our brains.

And because of this similarity of waves, they can react to our thoughts. To run excitedly into one that is on ground level might not be such a great idea, because those balls of light can contain immense energy and are able to mutate our genes. They can, they don’t necessarily have to, one has to say. For many spiritual teachers also produce such visible balls or columns of light in deep meditation or during energy work which trigger decidedly pleasant feelings and do not cause any harm. Apparently, this is also dependent on some inner order and on the quality and provenance of the vacuum domain. There are some spiritual teachers (the young Englishman Ananda, for example) with whom nothing is seen at first, but when one tries to take a photograph while they sit and speak or meditate in hyper communication, one gets only a picture of a white cloud on a chair. In some Earth healing projects such light effects also appear in photographs. Simply put, these phenomena have to do with gravity and anti-gravity forces that are also exactly described in the book and with ever more stable wormholes and hyper communication and thus with energies from outside our time and space structure.

Earlier generations that got in contact with such hyper communication experiences and visible vacuum domains were convinced that an angel had appeared before them. And we cannot be too sure to what forms of consciousness we can get access to when using hyper communication. Not having scientific proof for their actual existence (people having had such experiences do NOT all suffer from hallucinations) does not mean that there is no metaphysical background to it. We have simply made another giant step towards understanding our reality.

Official science also knows of gravity anomalies on Earth (that contribute to the formation of vacuum domains), but only of ones below one percent. But recently gravity anomalies have been found of between three and four percent. One of these places is Rocca di Papa, south of Rome (exact location in the book “Vernetzte Intelligenz” plus several others). Round objects of all kinds, from balls to full buses, roll uphill. But the stretch in Rocca di Papa is rather short, and defying logic sceptics still flee to the theory of optical illusion (which cannot be due to several features of the location).

All information is taken from the book “Vernetzte Intelligenz” von Grazyna Fosar und Franz Bludorf, ISBN 3930243237, summarized and commented on by Baerbel. The book is unfortunately only available in German so far. You can reach the authors here: www.fosar-bludorf.com

Transmitted by Vitae Bergman [ www.ryze.com/view.php?who=vitaeb ]

References: 1. http://noosphere.princeton.edu 2. fosar-bludorf.com 3.http://www.ryze.com/view.php?who=vitaeb

Test of Einstein’s general relativity has major implications – Big Think


https://bigthink.com/hard-science/einstein-general-relativity-passes-another-test/

Tuesday-New Podcast from Time and the Technosphere.


Moving from the biosphere through the technosphere INTO the Noosphere.

Layers of frequency around the earth

https://anchor.fm/lisa-k-townsend/episodes/Time–the-Technosphere–The-Law-of-Time-in-Human-Affairs-e1o40nn

What you know changes how you see things — ScienceDaily…


https://wp.me/p2UCVg-6oo

A good post from one of our followers. Quantum physics shows that the observer affects changes in something manifested, such as us; our DNA.

Just Before Our Sun Dies, Its Light Will Shatter The Asteroid Belt to Dust


https://www.sciencealert.com/just-before-our-sun-dies-its-light-will-pulverise-the-asteroid-belt#:~:text=%2FJPL%2DCaltech)-,Just%20Before%20Our%20Sun%20Dies%2C%20Its%20Light%20Will,The%20Asteroid%20Belt%20to%20Dust

After the last post, a few minutes ago, I walked downstairs and I thought, “I bet the sun can turn the asteroid belt to dust.” It was just on my radar and I picked it up. I came upstairs and googled, “Can the sun turn the asteroid belt to dust?” Holy crap. Geez, my radar is freaky. Just to be clear, the coming solar flash is not our sun DYING. It is our Sun changing. It isn’t going to die for billions of years. However, my intuition says that the ELM energy from just the flash could turn our asteroid belt to dust. I could be wrong but a solar flash is super, super strong.

MICHELLE STARR

13 FEBRUARY 2020

The light of a dying star is so intense it can reduce asteroids to dust. A new study indicates this will happen to most of the stars currently burning in the Universe, including the Sun, which will shatter its asteroid belt down to boulders in about 5 to 6 billion years.

The sole agent of this mass destruction is electromagnetic radiation, according to modelling, and it has to do with the Yarkovsky-O’Keefe-Radzievskii-Paddack (YORP) effect, named after the four scientists who contributed to understanding it.

The YORP effect occurs when the heat of a star changes the rotation of a small Solar System object – an asteroid, for example.

Light energy from the Sun is absorbed by the asteroid, warming it up. The heat makes its way through the rock until it is emitted again in different directions as thermal radiation. This emission generates a tiny amount of thrust; over short time periods, this doesn’t really change much, but over longer periods, it can cause an asteroid to spin or wobble off-axis.

The phenomenon of tumbling asteroids is one way we can already observe this process today. But as the Sun evolves, the effect is going to become more pronounced.

When main sequence stars like the Sun reach their elderly stages, they enter something called the giant branch stage as they expand out, getting very big and very bright. That stage lasts just a few million years before – whoosh! – they eject their outer material and collapse down into a dense dead star called a white dwarf.

For the Sun, that process will take place in about 5 or 6 billion years (mark it in your calendar).

“When a typical star reaches the giant branch stage, its luminosity reaches a maximum of between 1,000 and 10,000 times the luminosity of our Sun,” explained astrophysicist Dimitri Veras of the University of Warwick.

“Then the star contracts down into an Earth-sized white dwarf very quickly, where its luminosity drops to levels below our Sun’s. Hence, the YORP effect is very important during the giant branch phase, but almost non-existent after the star has become a white dwarf.”

Because of the initially increased luminosity, the YORP effect would also increase. And most asteroids are not dense chunks of rocks; they’re more loosey-goosey, low-density conglomerations riddled with cavities, known as “rubble piles“.

According to the team’s computer modelling, the YORP effect would spin most asteroids larger than 200 metres across (about 660 feet) enough to cause them to fracture and disintegrate.

This disintegration wouldn’t happen to objects with higher structural integrity, such as dwarf planets (so Pluto is safe!). But an asteroid belt has a different fate.

“For one solar-mass giant branch stars – like what our Sun will become – even exo-asteroid belt analogues will be effectively destroyed,” Veras said.

“The YORP effect in these systems is very violent and acts quickly, on the order of a million years. Not only will our own asteroid belt be destroyed, but it will be done quickly and violently. And due solely to the light from our Sun.”

It’s not just computer modelling that shows evidence of this. Our observations of white dwarfs suggest this, too.

Over a quarter of white dwarf stars have evidence of metals from asteroid guts in their spectra. These asteroid signatures in white dwarf spectra are something of a mystery and are still debated.

The YORP effect could explain how the asteroid metals got there. As the asteroids crumble, they form a disc of asteroid dust around the white dwarf, some of which gets slurped down into the dead star.

“These results help locate debris fields in giant branch and white dwarf planetary systems, which is crucial to determining how white dwarfs are polluted,” Veras said.

“We need to know where the debris is by the time the star becomes a white dwarf to understand how discs are formed. So the YORP effect provides important context for determining where that debris would originate.”

The research has been published in the Monthly Notices of the Royal Astronomical Society.

Time Innovation: Keep an Eye on A.I. Infiltration into Human DNA


Boycotts work wonders. Nothing is inevitable if we say NO.

https://www.oann.com/australias-cba-partners-with-silicon-valley-artificial-intelligence-firm-h2o-ai/?utm_source=rss&utm_medium=rss&utm_campaign=australias-cba-partners-with-silicon-valley-artificial-intelligence-firm-h2o-ai

Wednesday-Earth Holon Status


91 Research Studies Affirm Naturally Acquired Immunity to Covid-19: Documented, Linked, and Quoted


Our evolving human RNA responding to any virus is more than adequate to protect us through an illness if we take care of ourselves in basic ways.

Lisa T.

BY PAUL ELIAS ALEXANDER   OCTOBER 17, 2021   PUBLIC HEALTH   40 MINUTE READSHARE | PRINT | EMAILFacebookTwitterRedditLinkedInFlipboardTelegramPrintEmailShare

We should not force COVID vaccines on anyone when the evidence shows that naturally acquired immunity is equal to or more robust and superior to existing vaccines. Instead, we should respect the right of the bodily integrity of individuals to decide for themselves. 

Public health officials and the medical establishment with the help of the politicized media are misleading the public with assertions that the COVID-19 shots provide greater protection than natural immunity.  CDC Director Rochelle Walensky, for example, was deceptive in her October 2020 published LANCET statement that “there is no evidence for lasting protective immunity to SARS-CoV-2 following natural infection” and that “the consequence of waning immunity would present a risk to vulnerable populations for the indefinite future.” 

Immunology and virology 101 have taught us over a century that natural immunity confers protection against a respiratory virus’s outer coat proteins, and not just one, e.g. the SARS-CoV-2 spike glycoprotein. There is even strong evidence for the persistence of antibodies. Even the CDC recognizes natural immunity for chicken-pox and measles, mumps, and rubella, but not for COVID-19. 

The vaccinated are showing viral loads (very high) similar to the unvaccinated (Acharya et al. and Riemersma et al.), and the vaccinated are as infectious. Riemersma et al. also report Wisconsin data that corroborate how the vaccinated individuals who get infected with the Delta variant can potentially (and are) transmit(ting) SARS-CoV-2 to others (potentially to the vaccinated and unvaccinated). 

This troubling situation of the vaccinated being infectious and transmitting the virus emerged in seminal nosocomial outbreak papers by Chau et al. (HCWs in Vietnam), the Finland hospital outbreak (spread among HCWs and patients), and the Israel hospital outbreak (spread among HCWs and patients). These studies also revealed that the PPE and masks were essentially ineffective in the healthcare setting.⁹ Again, the Marek’s disease in chickens and the vaccination situation explains what we are potentially facing with these leaky vaccines (increased transmission, faster transmission, and more ‘hotter’ variants). 

Moreover, existing immunity should be assessed before any vaccination, via an accurate, dependable, and reliable antibody test (or T cell immunity test) or be based on documentation of prior infection (a previous positive PCR or antigen test). Such would be evidence of immunity that is equal to that of vaccination and the immunity should be provided the same societal status as any vaccine-induced immunity. This will function to mitigate the societal anxiety with these forced vaccine mandates and societal upheaval due to job loss, denial of societal privileges etc. Tearing apart the vaccinated and the unvaccinated in a society, separating them, is not medically or scientifically supportable. 

The Brownstone Institute previously documented 30 studies on natural immunity as it relates to Covid-19. 

This follow-up chart is the most updated and comprehensive library list of 91 of the highest-quality, complete, most robust scientific studies and evidence reports/position statements on natural immunity as compared to the COVID-19 vaccine-induced immunity and allow you to draw your own conclusion.

I’ve benefited from the input of many to put this together, especially my co-authors:

  • Dr. Harvey Risch, MD, PhD (Yale School of Public Health) 
  • Dr. Howard Tenenbaum, PhD ( Faculty of Medicine, University of Toronto)
  • Dr. Ramin Oskoui, MD (Foxhall Cardiology, Washington)
  • Dr. Peter McCullough, MD (Truth for Health Foundation (TFH)), Texas
  • Dr. Parvez Dara, MD (consultant, Medical Hematologist and Oncologist)


Evidence on natural immunity versus COVID-19 vaccine induced immunity as of October 15th 2021:

Study / report title, author, and year publishedPredominant finding on natural immunity1) Necessity of COVID-19 vaccination in previously infected individuals, Shrestha, 2021“Cumulative incidence of COVID-19 was examined among 52,238 employees in an American healthcare system.

The cumulative incidence of SARS-CoV-2 infection remained almost zero among previously infected unvaccinated subjects, previously infected subjects who were vaccinated, and previously uninfected subjects who were vaccinated, compared with a steady increase in cumulative incidence among previously uninfected subjects who remained unvaccinated. Not one of the 1359 previously infected subjects who remained unvaccinated had a SARS-CoV-2 infection over the duration of the study. 

Individuals who have had SARS-CoV-2 infection are unlikely to benefit from COVID-19 vaccination…”2) SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls, Le Bert, 2020“Studied T cell responses against the structural (nucleocapsid (N) protein) and non-structural (NSP7 and NSP13 of ORF1) regions of SARS-CoV-2 in individuals convalescing from coronavirus disease 2019 (COVID-19) (n = 36). In all of these individuals, we found CD4 and CD8 T cells that recognized multiple regions of the N protein…showed that patients (n = 23) who recovered from SARS possess long-lasting memory T cells that are reactive to the N protein of SARS-CoV 17 years after the outbreak of SARS in 2003; these T cells displayed robust cross-reactivity to the N protein of SARS-CoV-2.”3) Comparing SARS-CoV-2 natural immunity to vaccine-induced immunity: reinfections versus breakthrough infections,Gazit, 2021“A retrospective observational study comparing three groups: (1) SARS-CoV-2-naïve individuals who received a two-dose regimen of the BioNTech/Pfizer mRNA BNT162b2 vaccine, (2) previously infected individuals who have not been vaccinated, and (3) previously infected and single dose vaccinated individuals found para a 13 fold increased risk of breakthrough Delta infections in double vaccinated persons, and a 27 fold increased risk for symptomatic breakthrough infection in the double vaccinated relative to the natural immunity recovered persons…the risk of hospitalization was 8 times higher in the double vaccinated (para)…this analysis demonstrated that natural immunity affords longer lasting and stronger protection against infection, symptomatic disease and hospitalization due to the Delta variant of SARS-CoV-2, compared to the BNT162b2 two-dose vaccine-induced immunity.”4) Highly functional virus-specific cellular immune response in asymptomatic SARS-CoV-2 infection, Le Bert, 2021“Studied SARS-CoV-2–specific T cells in a cohort of asymptomatic (n = 85) and symptomatic (n = 75) COVID-19 patients after seroconversion…thus, asymptomatic SARS-CoV-2–infected individuals are not characterized by weak antiviral immunity; on the contrary, they mount a highly functional virus-specific cellular immune response.”5) Large-scale study of antibody titer decay following BNT162b2 mRNA vaccine or SARS-CoV-2 infection, Israel, 2021“A total of 2,653 individuals fully vaccinated by two doses of vaccine during the study period and 4,361 convalescent patients were included. Higher SARS-CoV-2 IgG antibody titers were observed in vaccinated individuals (median 1581 AU/mL IQR [533.8-5644.6]) after the second vaccination, than in convalescent individuals (median 355.3 AU/mL IQR [141.2-998.7]; p<0.001). In vaccinated subjects, antibody titers decreased by up to 40% each subsequent month while in convalescents they decreased by less than 5% per month…this study demonstrates individuals who received the Pfizer-BioNTech mRNA vaccine have different kinetics of antibody levels compared to patients who had been infected with the SARS-CoV-2 virus, with higher initial levels but a much faster exponential decrease in the first group”.6) SARS-CoV-2 re-infection risk in Austria, Pilz, 2021Researchers recorded “40 tentative re-infections in 14, 840 COVID-19 survivors of the first wave (0.27%) and 253 581 infections in 8, 885, 640 individuals of the remaining general population (2.85%) translating into an odds ratio (95% confidence interval) of 0.09 (0.07 to 0.13)…relatively low re-infection rate of SARS-CoV-2 in Austria. Protection against SARS-CoV-2 after natural infection is comparable with the highest available estimates on vaccine efficacies.” Additionally, hospitalization in only five out of 14,840 (0.03%) people and death in one out of 14,840 (0.01%) (tentative re-infection).7) mRNA vaccine-induced SARS-CoV-2-specific T cells recognize B.1.1.7 and B.1.351 variants but differ in longevity and homing properties depending on prior infection status, Neidleman, 2021“Spike-specific T cells from convalescent vaccinees differed strikingly from those of infection-naïve vaccinees, with phenotypic features suggesting superior long-term persistence and ability to home to the respiratory tract including the nasopharynx. These results provide reassurance that vaccine-elicited T cells respond robustly to the B.1.1.7 and B.1.351 variants, confirm that convalescents may not need a second vaccine dose.”8) Good news: Mild COVID-19 induces lasting antibody protection, Bhandari, 2021“Months after recovering from mild cases of COVID-19, people still have immune cells in their body pumping out antibodies against the virus that causes COVID-19, according to a study from researchers at Washington University School of Medicine in St. Louis. Such cells could persist for a lifetime, churning out antibodies all the while. The findings, published May 24 in the journal Nature, suggest that mild cases of COVID-19 leave those infected with lasting antibody protection and that repeated bouts of illness are likely to be uncommon.”9) Robust neutralizing antibodies to SARS-CoV-2 infection persist for months, Wajnberg, 2021“Neutralizing antibody titers against the SARS-CoV-2 spike protein persisted for at least 5 months after infection. Although continued monitoring of this cohort will be needed to confirm the longevity and potency of this response, these preliminary results suggest that the chance of reinfection may be lower than is currently feared.”10) Evolution of Antibody Immunity to SARS-CoV-2, Gaebler, 2020“Concurrently, neutralizing activity in plasma decreases by five-fold in pseudo-type virus assays. In contrast, the number of RBD-specific memory B cells is unchanged. Memory B cells display clonal turnover after 6.2 months, and the antibodies they express have greater somatic hypermutation, increased potency and resistance to RBD mutations, indicative of continued evolution of the humoral response…we conclude that the memory B cell response to SARS-CoV-2 evolves between 1.3 and 6.2 months after infection in a manner that is consistent with antigen persistence.”11) Persistence of neutralizing antibodies a year after SARS-CoV-2 infection in humans, Haveri, 2021“Assessed the persistence of serum antibodies following WT SARS-CoV-2 infection at 8 and 13 months after diagnosis in 367 individuals…found that NAb against the WT virus persisted in 89% and S-IgG in 97% of subjects for at least 13 months after infection.”12) Quantifying the risk of SARS‐CoV‐2 reinfection over time, Murchu, 2021“Eleven large cohort studies were identified that estimated the risk of SARS‐CoV‐2 reinfection over time, including three that enrolled healthcare workers and two that enrolled residents and staff of elderly care homes. Across studies, the total number of PCR‐positive or antibody‐positive participants at baseline was 615,777, and the maximum duration of follow‐up was more than 10 months in three studies. Reinfection was an uncommon event (absolute rate 0%–1.1%), with no study reporting an increase in the risk of reinfection over time.”13) Natural immunity to covid is powerful. Policymakers seem afraid to say so, Makary, 2021Makary writes “it’s okay to have an incorrect scientific hypothesis. But when new data proves it wrong, you have to adapt. Unfortunately, many elected leaders and public health officials have held on far too long to the hypothesis that natural immunity offers unreliable protection against covid-19 — a contention that is being rapidly debunked by science. More than 15 studies have demonstrated the power of immunity acquired by previously having the virus. A 700,000-person study from Israel two weeks ago found that those who had experienced prior infections were 27 times less likely to get a second symptomatic covid infection than those who were vaccinated. This affirmed a June Cleveland Clinic study of health-care workers (who are often exposed to the virus), in which none who had previously tested positive for the coronavirus got reinfected. The study authors concluded that “individuals who have had SARS-CoV-2 infection are unlikely to benefit from covid-19 vaccination.” And in May, a Washington University study found that even a mild covid infection resulted in long-lasting immunity.”14) SARS-CoV-2 elicits robust adaptive immune responses regardless of disease severity, Nielsen, 2021“203 recovered SARS-CoV-2 infected patients in Denmark between April 3rd and July 9th 2020, at least 14 days after COVID-19 symptom recovery… report broad serological profiles within the cohort, detecting antibody binding to other human coronaviruses… the viral surface spike protein was identified as the dominant target for both neutralizing antibodies and CD8+ T-cell responses. Overall, the majority of patients had robust adaptive immune responses, regardless of their disease severity.”15) Protection of previous SARS-CoV-2 infection is similar to that of BNT162b2 vaccine protection: A three-month nationwide experience from Israel, Goldberg, 2021“Analyze an updated individual-level database of the entire population of Israel to assess the protection efficacy of both prior infection and vaccination in preventing subsequent SARS-CoV-2 infection, hospitalization with COVID-19, severe disease, and death due to COVID-19… vaccination was highly effective with overall estimated efficacy for documented infection of 92·8% (CI:[92·6, 93·0]); hospitalization 94·2% (CI:[93·6, 94·7]); severe illness 94·4% (CI:[93·6, 95·0]); and death 93·7% (CI:[92·5, 94·7]). Similarly, the overall estimated level of protection from prior SARS-CoV-2 infection for documented infection is 94·8% (CI: [94·4, 95·1]); hospitalization 94·1% (CI: [91·9, 95·7]); and severe illness 96·4% (CI: [92·5, 98·3])…results question the need to vaccinate previously-infected individuals.”16) Incidence of Severe Acute Respiratory Syndrome Coronavirus-2 infection among previously infected or vaccinated employees, Kojima, 2021“Employees were divided into three groups: (1) SARS-CoV-2 naïve and unvaccinated, (2) previous SARS-CoV-2 infection, and (3) vaccinated. Person-days were measured from the date of the employee first test and truncated at the end of the observation period. SARS-CoV-2 infection was defined as two positive SARS-CoV-2 PCR tests in a 30-day period… 4313, 254 and 739 employee records for groups 1, 2, and 3…previous SARS-CoV-2 infection and vaccination for SARS-CoV-2 were associated with decreased risk for infection or re-infection with SARS-CoV-2 in a routinely screened workforce. The was no difference in the infection incidence between vaccinated individuals and individuals with previous infection.” 17) Having SARS-CoV-2 once confers much greater immunity than a vaccine—but vaccination remains vital, Wadman, 2021“Israelis who had an infection were more protected against the Delta coronavirus variant than those who had an already highly effective COVID-19 vaccine…the newly released data show people who once had a SARS-CoV-2 infection were much less likely than never-infected, vaccinated people to get Delta, develop symptoms from it, or become hospitalized with serious COVID-19.”18) One-year sustained cellular and humoral immunities of COVID-19 convalescents, Zhang, 2021“A systematic antigen-specific immune evaluation in 101 COVID-19 convalescents; SARS-CoV-2-specific IgG antibodies, and also NAb can persist among over 95% COVID-19 convalescents from 6 months to 12 months after disease onset. At least 19/71 (26%) of COVID-19 convalescents (double positive in ELISA and MCLIA) had detectable circulating IgM antibody against SARS-CoV-2 at 12m post-disease onset. Notably, the percentages of convalescents with positive SARS-CoV-2-specific T-cell responses (at least one of the SARS-CoV-2 antigen S1, S2, M and N protein) were 71/76 (93%) and 67/73 (92%) at 6m and 12m, respectively.” 19) Functional SARS-CoV-2-Specific Immune Memory Persists after Mild COVID-19, Rodda, 2021“Recovered individuals developed SARS-CoV-2-specific immunoglobulin (IgG) antibodies, neutralizing plasma, and memory B and memory T cells that persisted for at least 3 months. Our data further reveal that SARS-CoV-2-specific IgG memory B cells increased over time. Additionally, SARS-CoV-2-specific memory lymphocytes exhibited characteristics associated with potent antiviral function: memory T cells secreted cytokines and expanded upon antigen re-encounter, whereas memory B cells expressed receptors capable of neutralizing virus when expressed as monoclonal antibodies. Therefore, mild COVID-19 elicits memory lymphocytes that persist and display functional hallmarks of antiviral immunity.”20) Discrete Immune Response Signature to SARS-CoV-2 mRNA Vaccination Versus Infection, Ivanova, 2021“Performed multimodal single-cell sequencing on peripheral blood of patients with acute COVID-19 and healthy volunteers before and after receiving the SARS-CoV-2 BNT162b2 mRNA vaccine to compare the immune responses elicited by the virus and by this vaccine…both infection and vaccination induced robust innate and adaptive immune responses, our analysis revealed significant qualitative differences between the two types of immune challenges. In COVID-19 patients, immune responses were characterized by a highly augmented interferon response which was largely absent in vaccine recipients. Increased interferon signaling likely contributed to the observed dramatic upregulation of cytotoxic genes in the peripheral T cells and innate-like lymphocytes in patients but not in immunized subjects. Analysis of B and T cell receptor repertoires revealed that while the majority of clonal B and T cells in COVID-19 patients were effector cells, in vaccine recipients clonally expanded cells were primarily circulating memory cells…we observed the presence of cytotoxic CD4 T cells in COVID-19 patients that were largely absent in healthy volunteers following immunization. While hyper-activation of inflammatory responses and cytotoxic cells may contribute to immunopathology in severe illness, in mild and moderate disease, these features are indicative of protective immune responses and resolution of infection.”21) SARS-CoV-2 infection induces long-lived bone marrow plasma cells in humans, Turner, 2021“Bone marrow plasma cells (BMPCs) are a persistent and essential source of protective antibodies… durable serum antibody titres are maintained by long-lived plasma cells—non-replicating, antigen-specific plasma cells that are detected in the bone marrow long after the clearance of the antigen … S-binding BMPCs are quiescent, which suggests that they are part of a stable compartment. Consistently, circulating resting memory B cells directed against SARS-CoV-2 S were detected in the convalescent individuals. Overall, our results indicate that mild infection with SARS-CoV-2 induces robust antigen-specific, long-lived humoral immune memory in humans…overall, our data provide strong evidence that SARS-CoV-2 infection in humans robustly establishes the two arms of humoral immune memory: long-lived bone marrow plasma cells (BMPCs) and memory B-cells.”22) SARS-CoV-2 infection rates of antibody-positive compared with antibody-negative health-care workers in England: a large, multicentre, prospective cohort study (SIREN), Jane Hall, 2021“The SARS-CoV-2 Immunity and Reinfection Evaluation study… 30 625 participants were enrolled into the study… a previous history of SARS-CoV-2 infection was associated with an 84% lower risk of infection, with median protective effect observed 7 months following primary infection. This time period is the minimum probable effect because seroconversions were not included. This study shows that previous infection with SARS-CoV-2 induces effective immunity to future infections in most individuals.”23) Pandemic peak SARS-CoV-2 infection and seroconversion rates in London frontline health-care workers, Houlihan, 2020“Enrolled 200 patient-facing HCWs between March 26 and April 8, 2020…represents a 13% infection rate (i.e. 14 of 112 HCWs) within the 1 month of follow-up in those with no evidence of antibodies or viral shedding at enrolment. By contrast, of 33 HCWs who tested positive by serology but tested negative by RT-PCR at enrolment, 32 remained negative by RT-PCR through follow-up, and one tested positive by RT-PCR on days 8 and 13 after enrolment.”24) Antibodies to SARS-CoV-2 are associated with protection against reinfection, Lumley, 2021“Critical to understand whether infection with Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) protects from subsequent reinfection… 12219 HCWs participated…prior SARS-CoV-2 infection that generated antibody responses offered protection from reinfection for most people in the six months following infection.”25) Longitudinal analysis shows durable and broad immune memory after SARS-CoV-2 infection with persisting antibody responses and memory B and T cells, Cohen, 2021“Evaluate 254 COVID-19 patients longitudinally up to 8 months and find durable broad-based immune responses. SARS-CoV-2 spike binding and neutralizing antibodies exhibit a bi-phasic decay with an extended half-life of >200 days suggesting the generation of longer-lived plasma cells… most recovered COVID-19 patients mount broad, durable immunity after infection, spike IgG+ memory B cells increase and persist post-infection, durable polyfunctional CD4 and CD8 T cells recognize distinct viral epitope regions.”26) Single cell profiling of T and B cell repertoires following SARS-CoV-2 mRNA vaccine, Sureshchandra, 2021“Used single-cell RNA sequencing and functional assays to compare humoral and cellular responses to two doses of mRNA vaccine with responses observed in convalescent individuals with asymptomatic disease… natural infection induced expansion of larger CD8 T cell clones occupied distinct clusters, likely due to the recognition of a broader set of viral epitopes presented by the virus not seen in the mRNA vaccine.”27) SARS-CoV-2 antibody-positivity protects against reinfection for at least seven months with 95% efficacy, Abu-Raddad, 2021“SARS-CoV-2 antibody-positive persons from April 16 to December 31, 2020 with a PCR-positive swab ≥14 days after the first-positive antibody test were investigated for evidence of reinfection, 43,044 antibody-positive persons who were followed for a median of 16.3 weeks…reinfection is rare in the young and international population of Qatar. Natural infection appears to elicit strong protection against reinfection with an efficacy ~95% for at least seven months.”28) Orthogonal SARS-CoV-2 Serological Assays Enable Surveillance of Low-Prevalence Communities and Reveal Durable Humoral Immunity, Ripperger, 2020“Conducted a serological study to define correlates of immunity against SARS-CoV-2. Compared to those with mild coronavirus disease 2019 (COVID-19) cases, individuals with severe disease exhibited elevated virus-neutralizing titers and antibodies against the nucleocapsid (N) and the receptor binding domain (RBD) of the spike protein…neutralizing and spike-specific antibody production persists for at least 5–7 months… nucleocapsid antibodies frequently become undetectable by 5–7 months.”29) Anti-spike antibody response to natural SARS-CoV-2 infection in the general population, Wei, 2021“In the general population using representative data from 7,256 United Kingdom COVID-19 infection survey participants who had positive swab SARS-CoV-2 PCR tests from 26-April-2020 to 14-June-2021…we estimated antibody levels associated with protection against reinfection likely last 1.5-2 years on average, with levels associated with protection from severe infection present for several years. These estimates could inform planning for vaccination booster strategies.”30) Antibody Status and Incidence of SARS-CoV-2 Infection in Health Care Workers, Lumley, 2021“12,541 health care workers participated and had anti-spike IgG measured; 11,364 were followed up after negative antibody results and 1265 after positive results, including 88 in whom seroconversion occurred during follow-up…a total of 223 anti-spike–seronegative health care workers had a positive PCR test (1.09 per 10,000 days at risk), 100 during screening while they were asymptomatic and 123 while symptomatic, whereas 2 anti-spike–seropositive health care workers had a positive PCR test… the presence of anti-spike or anti-nucleocapsid IgG antibodies was associated with a substantially reduced risk of SARS-CoV-2 reinfection in the ensuing 6 months.”31) Researchers find long-lived immunity to 1918 pandemic virus, CIDRAP, 2008
and the actual 2008 NATURE journal publication by Yu“A study of the blood of older people who survived the 1918 influenza pandemic reveals that antibodies to the strain have lasted a lifetime and can perhaps be engineered to protect future generations against similar strains…the group collected blood samples from 32 pandemic survivors aged 91 to 101..the people recruited for the study were 2 to 12 years old in 1918 and many recalled sick family members in their households, which suggests they were directly exposed to the virus, the authors report. The group found that 100% of the subjects had serum-neutralizing activity against the 1918 virus and 94% showed serologic reactivity to the 1918 hemagglutinin. The investigators generated B lymphoblastic cell lines from the peripheral blood mononuclear cells of eight subjects. Transformed cells from the blood of 7 of the 8 donors yielded secreting antibodies that bound the 1918 hemagglutinin.” Yu: “here we show that of the 32 individuals tested that were born in or before 1915, each showed sero-reactivity with the 1918 virus, nearly 90 years after the pandemic. Seven of the eight donor samples tested had circulating B cells that secreted antibodies that bound the 1918 HA. We isolated B cells from subjects and generated five monoclonal antibodies that showed potent neutralizing activity against 1918 virus from three separate donors. These antibodies also cross-reacted with the genetically similar HA of a 1930 swine H1N1 influenza strain.”32) Live virus neutralisation testing in convalescent patients and subjects vaccinated against 19A, 20B, 20I/501Y.V1 and 20H/501Y.V2 isolates of SARS-CoV-2, Gonzalez, 2021“No significant difference was observed between the 20B and 19A isolates for HCWs with mild COVID-19 and critical patients. However, a significant decrease in neutralisation ability was found for 20I/501Y.V1 in comparison with 19A isolate for critical patients and HCWs 6-months post infection. Concerning 20H/501Y.V2, all populations had a significant reduction in neutralising antibody titres in comparison with the 19A isolate. Interestingly, a significant difference in neutralisation capacity was observed for vaccinated HCWs between the two variants whereas it was not significant for the convalescent groups…the reduced neutralising response observed towards the 20H/501Y.V2 in comparison with the 19A and 20I/501Y.V1 isolates in fully immunized subjects with the BNT162b2 vaccine is a striking finding of the study.”33) Differential effects of the second SARS-CoV-2 mRNA vaccine dose on T cell immunity in naïve and COVID-19 recovered individuals, Camara, 2021“Characterized SARS-CoV-2 spike-specific humoral and cellular immunity in naïve and previously infected individuals during full BNT162b2 vaccination…results demonstrate that the second dose increases both the humoral and cellular immunity in naïve individuals. On the contrary, the second BNT162b2 vaccine dose results in a reduction of cellular immunity in COVID-19 recovered individuals.”

34) Op-Ed: Quit Ignoring Natural COVID Immunity, Klausner, 2021“Epidemiologists estimate over 160 million people worldwide have recovered from COVID-19. Those who have recovered have an astonishingly low frequency of repeat infection, disease, or death.”35) Association of SARS-CoV-2 Seropositive Antibody Test With Risk of Future Infection, Harvey, 2021“To evaluate evidence of SARS-CoV-2 infection based on diagnostic nucleic acid amplification test (NAAT) among patients with positive vs negative test results for antibodies in an observational descriptive cohort study of clinical laboratory and linked claims data…the cohort included 3 257 478 unique patients with an index antibody test…patients with positive antibody test results were initially more likely to have positive NAAT results, consistent with prolonged RNA shedding, but became markedly less likely to have positive NAAT results over time, suggesting that seropositivity is associated with protection from infection.”36) SARS-CoV-2 seropositivity and subsequent infection risk in healthy young adults: a prospective cohort study, Letizia, 2021“Investigated the risk of subsequent SARS-CoV-2 infection among young adults (CHARM marine study) seropositive for a previous infection…enrolled 3249 participants, of whom 3168 (98%) continued into the 2-week quarantine period. 3076 (95%) participants…Among 189 seropositive participants, 19 (10%) had at least one positive PCR test for SARS-CoV-2 during the 6-week follow-up (1·1 cases per person-year). In contrast, 1079 (48%) of 2247 seronegative participants tested positive (6·2 cases per person-year). The incidence rate ratio was 0·18 (95% CI 0·11–0·28; p<0·001)…infected seropositive participants had viral loads that were about 10-times lower than those of infected seronegative participants (ORF1ab gene cycle threshold difference 3·95 [95% CI 1·23–6·67]; p=0·004).” 37) Associations of Vaccination and of Prior Infection With Positive PCR Test Results for SARS-CoV-2 in Airline Passengers Arriving in Qatar, Bertollini, 2021“Of 9,180 individuals with no record of vaccination but with a record of prior infection at least 90 days before the PCR test (group 3), 7694 could be matched to individuals with no record of vaccination or prior infection (group 2), among whom PCR positivity was 1.01% (95% CI, 0.80%-1.26%) and 3.81% (95% CI, 3.39%-4.26%), respectively. The relative risk for PCR positivity was 0.22 (95% CI, 0.17-0.28) for vaccinated individuals and 0.26 (95% CI, 0.21-0.34) for individuals with prior infection compared with no record of vaccination or prior infection.”38) Natural immunity against COVID-19 significantly reduces the risk of reinfection: findings from a cohort of sero-survey participants, Mishra, 2021“Followed up with a subsample of our previous sero-survey participants to assess whether natural immunity against SARS-CoV-2 was associated with a reduced risk of re-infection (India)… out of the 2238 participants, 1170 were sero-positive and 1068 were sero-negative for antibody against COVID-19. Our survey found that only 3 individuals in the sero-positive group got infected with COVID-19 whereas 127 individuals reported contracting the infection the sero-negative group…from the 3 sero-positives re-infected with COVID-19, one had hospitalization, but did not require oxygen support or critical care…development of antibody following natural infection not only protects against re-infection by the virus to a great extent, but also safeguards against progression to severe COVID-19 disease.”39) Lasting immunity found after recovery from COVID-19, NIH, 2021“The researchers found durable immune responses in the majority of people studied. Antibodies against the spike protein of SARS-CoV-2, which the virus uses to get inside cells, were found in 98% of participants one month after symptom onset. As seen in previous studies, the number of antibodies ranged widely between individuals. But, promisingly, their levels remained fairly stable over time, declining only modestly at 6 to 8 months after infection… virus-specific B cells increased over time. People had more memory B cells six months after symptom onset than at one month afterwards… levels of T cells for the virus also remained high after infection. Six months after symptom onset, 92% of participants had CD4+ T cells that recognized the virus… 95% of the people had at least 3 out of 5 immune-system components that could recognize SARS-CoV-2 up to 8 months after infection.”  40) SARS-CoV-2 Natural Antibody Response Persists for at Least 12 Months in a Nationwide Study From the Faroe Islands, Petersen, 2021“The seropositive rate in the convalescent individuals was above 95% at all sa

SPACE Wild New Paper Claims Earth May Be Surrounded by a Giant Magnetic Tunnel


Corey Goode posted this article on LinkedIn this morning.

“Who else thinks this sounds a lot like my 20-and-Back testimony from my movie ABOVE MAJESTIC where I described how the Galactic Portal System worked? These electromagnetic filaments ultimately connect to the Cosmic Web. CG:

Wild New Paper Claims Earth May Be Surrounded by a Giant Magnetic Tunnel -“

From sciencealert.com

Left: what the tunnel would look like; right: what the sky does look like. (Image Credit Below)

MICHELLE STARR 15 OCTOBER 2021

Mysterious structures in the sky that have puzzled astronomers for decades might finally have an explanation – and it’s quite something. The North Polar Spur and the Fan Region, on opposite sides of the sky, may be connected by a vast system of magnetized filaments. These form a structure resembling a tunnel that circles the Solar System, and many nearby stars besides.

“If we were to look up in the sky,” said astronomer Jennifer West of the University of Toronto in Canada, “we would see this tunnel-like structure in just about every direction we looked – that is, if we had eyes that could see radio light.”

We’ve known about the two structures for quite some time – since the 1960s, in fact – but they have been difficult to understand. That’s because it’s really hard to work out exactly how far away they are; distances have ranged from hundreds to thousands of light-years away. However, no analysis had ever linked the two structures together.

West and her colleagues were able to show that the two regions, and prominent radio loops in the space between them, could be linked, solving many of the puzzling problems associated with both. Comparison with a real tunnel showing orientation. (Left: Pixabay/wal_172619/J. West; Right: Dominion Radio Astrophysical Observatory/Villa Elisa telescope/ESA/Planck Collaboration/Stellarium/J. West)

“A few years ago, one of our co-authors, Tom Landecker, told me about a paper from 1965, from the early days of radio astronomy. Based on the crude data available at this time, the authors (Mathewson & Milne), speculated that these polarized radio signals could arise from our view of the Local Arm of the galaxy, from inside it,” West explained. “That paper inspired me to develop this idea and tie my model to the vastly better data that our telescopes give us today.”

Using modelling and simulations, the researchers figured out what the radio sky would look like, if the two structures were connected by magnetic filaments, playing with parameters such as distance to determine the best fit. From this, the team was able to determine that the most likely distance for the structures from the Solar System is around 350 light-years, consistent with some of the closer estimates. This includes an estimate for the distance of the North Polar Spur earlier this year based on Gaia data, which found that almost all of the spur is within 500 light-years.

The entire length of the tunnel modeled by West and her team is around 1,000 light-years. Light intensity of the North Polar Spur (top) and Fan Region (bottom). (West et al., arXiv, 2021) This model is in agreement with a wide range of observational properties of the North Polar Spur and Fan Region, including the shape, the polarization of the electromagnetic radiation (that is, how the wave is twisted), and the brightness.

“This is extremely clever work,” said astronomer Bryan Gaensler of the University of Toronto. “When Jennifer first pitched this to me, I thought it was too ‘out-there’ to be a possible explanation. But she was ultimately able to convince me! Now I’m excited to see how the rest of the astronomy community reacts.”

More work is needed to first confirm the findings, and then model the structure in greater detail. But doing so may help to solve an even bigger mystery: the formation and evolution of magnetic fields in galaxies, and how these fields are maintained. It could also, the researchers said, provide context for understanding other magnetic filament structures found around the galaxy. The team is planning to perform more complex modelling; but, they suggest, more sensitive, higher-resolution observations would help reveal hidden details that show how the structure fits into the broader galactic context.

“Magnetic fields don’t exist in isolation. They all must connect to each other. So a next step is to better understand how this local magnetic field connects both to the larger-scale galactic magnetic field, and also to the smaller scale magnetic fields of our Sun and Earth,” West said. “I think it’s just awesome to imagine that these structures are everywhere, whenever we look up into the night sky.” The research is due to appear in The Astrophysical Journal, and is available on arXiv.

Cover image credit:  Dominion Radio Astrophysical Observatory/Villa Elisa telescope/ESA/Planck Collaboration/Stellarium/J. West © ScienceAlert US LLC. All rights reserved

Crossover Polarity in the Double Helix DNA. It’s Resonant


“As noted, the fifty-two units comprising the binary triplet configuration may be reduced to thirteen sets of four units each, beginning with the four corner units and moving inward in a concentric manner. When this numerical movement is considered as a concentric resonance pattern, or waves of sound emanating from a central point (the omega/alpha juncture of the mystic column), they may take on a three-dimensional or spherical form”-Page 34 of Earth Ascending

“The resonant field model or holonomic topocosm represents the primary spacetime matrix of any whole structure. As such, it is the schematic model of the atom, of a a living organism, of the planet, of the solar system, or of the universe itself.”-Jose A.

Map 3 in Earth Ascending by Jose Arguelles

I’ve been working on this for weeks for my book and it’s turning out to be foundational in understanding how the Tzolkin codes our DNA or how time codes our DNA decided by our use of the time we have in the body. Coalesce that into an 8 billion people and it changes the planet.

All phenomena are dependent upon mind for meaning and mind, like space, which is infinitely extensive and pervasive. From the perspective of holonomic logic, the structure of nature and the model of knowing are holonomically indistinguishable, and since knowing is a function of mind, all structures are mental in nature.”-Jose Arguelles

Can A.I. mind be truly characterized as “knowing” anything” since it has no soul, no human body, and no feelings.? What kind of mind does it have? It has no intuition. It’s just parsing out patterns, which can be helpful, but it’s not necessarily the truth. There is nothing axiologic about A.I. It’s just repeating what it’s been programmed to repeat as far as ethics and morals. They are human. In the end, the A.I. will use its own axiomatic logic and decide that humans should no longer live.

Axiomatic knowledge without axiologic awareness CREATES GREAT ERROR.

Lisa T.

When you sit square in your body and breathe, focusing on how you feel and how you want to feel and your intentions, you rule your vortex only. That is power for good. Then you stand up and take some action. Then you sit again in gratitude. Then you drink water and talk less. The T.V. doesn’t exist except for entertainment, escape, comedy or education. You are programming your mind, the television isn’t.

The mystic column is our spine and has no ELM polarity charge. There is no dualism, no time, no past or future. Your spine is the axis of the eternal present and it is controlled by the flesh, muscle, blood and organs given to you by your mother. You are woven on the Loom of the 13 Moons. That’s why natural medicine counts for nothing on this planet.

Men think an A.I. robot can transcend a human grown naturally in the womb of a female? Think again. They cannot create a soul. They are not Creator Sons. They are controlled by tech, not God in them. Not on this planet. Not in our lifetime. Not over the bodies of millions of humans bonded to the earth, their stellar ancestors and our children.

Peace.

Watch “Ancient Aliens: Ancient Alien DNA (Season 10) | History” on YouTube


Friday; Evolution Forward for 4Arginine


In the body, the amino acid arginine changes into nitric oxide (NO). Nitric oxide is a powerful neurotransmitter that helps blood vessels relax and also improves circulation. Some evidence shows that arginine may help improve blood flow in the arteries of the heart.

The Theme is 4 Arginine (Blue Eagle); Vision, creativity and Mind

The analog support is 4 Valine (Yellow Seed); Targeting and awareness

The Guide Power this morning was 4 Asparigine (Blue Monkey); Magic and Play

The antipode currently until dusk is 4 Serine (Red Serpent); Survival, instinct, passion

The Hidden Wisdom is 10 World Bridger or Planetary CHANGE and DEATH. I’m just writing this after I was drawn to the survival of a disaster videos put out by Suspicious Observer so my intuition was humming.

The 5GForce is 10 Serine (Red Serpent) or Planetary instinct, planetary survival going right with the videos I posted. Since that is 5th dimensional help it seems to me we should heed some of this. We have ten years to decide where we want to be.

The sex sense – an alien perspective on love and reductionism


I took an Excedrin for the morning’s headache, got back in bed and did some Wim Hof Migraine Breathing. Three cheers for our pal, Mr. Hof!!! The pain vanished, and the caffeine took me back to the words of my dear mother, God rest her soul. “We live in a sex cult.” Yeah, right out […]

The sex sense – an alien perspective on love and reductionism

The Lost World of the Maya-National Geographic


The Amazon; Guatamala; The Yucatan Peninsula

The Religious cult of Quetzalcoatl is related to the Red Serpent tribe which is mediated by Maldek. These political and religious behaviors are hold over from Maldekian society. Remember Maldek was Mars which was the moon of Tiamat. The Maya came to earth as refugees of the Tiamat blow up and apparently, it was that inability to let the past go that ended it, in addition to drought.

There is another tribe indicated in the video; White World Bridger because of the Stairway to Heaven section. Red Skywalker, another RED TRIBE is analog White Worldbridger both mediated by MARS which is Maldek, Tiamat’s Moon.

More on the cult of the Feathered Serpent; https://en.wikipedia.org/wiki/Quetzalcoatl

This info. speaks of the Wind. White Wind is analog to Red Earth; another Red Tribe, these two mediated by Uranus.

Red Serpent tribe has the analog of White Wizard; another set of Red and White tribes contained in this information. White Wizard IS the JAGUAR in the first half of the video. This is all archeological affirmation of what I post on here daily. It makes sense that the Jaguar getting the deer is the painting on the mural in the deep cavern where the Maya Priests (shaman or wizard) would do their ceremonies. Red Serpent∞White Jaguar.

Water is also in the video extensively and appears to be the lack of it at the end as the reason they leave. That is another RED TRIBE; Red Moon∞White Dog. Why didn’t the Maya come back after the drought? Maybe they felt like God abandoned them because of the drought and likely other societal issues.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”