The Sun IS Sentient and Has It’s Own Type of DNA. The Sun is our Mother…and Father. Everything in the Universe is Gender Balanced. Earth needs to Copy That.
I’m not saying the sun is any less sentient than the 10 planets, or that it’s not evolving also in its own way. But it’s not in charge of the local system cycles. The Tzolkin Harmonic is in charge of the local system cycles for Earth (the moon), Mars, Mercury, Venus, The Sun ( a star), the asteroid belt, Jupiter, Saturn, Uranus, Neptune, Pluto, and the Kuiper Belt.
They’re going to have to read my book, “Time is DNA” “Earth Ascending” and many other great books on the power of the Tzolkin Harmonic and its exponential cycles. It’s been ignored and denigrated by the Science narrative for too long, probably because its coordinate is 13:20 instead of 12:60. Our bodies don’t follow a mechanistic clock or a B.S. Gregorian Calendar put in place to confuse our mind, body, and spirit. We evolve according to a 26,000-year cycle.
I’m sorry so many people are superstitious about the number thirteen that brings BALANCE of power to females and males but that is the way of the universe. Human tradition’s way is not the Universe’s way, the evil and error that reigns supreme in science and government on Earth are trying to mandate to all humans that it’s their way or the highway. It’s not going to work. Take to the highway please with your lack of understanding of what earth wills and needs and Universal Law that accords empowerment to EVERYONE no matter what gender or culture. Human insecurity and ego are going to have to submit to the larger universal cycles and what’s good for the collective survival of those on the planet that want to stay during our ascension. What the scientists surmise from past cycles and their own fears will not dictate or usurp the will of individuals in a region.
If someone (or a large group) sits in fear, hates the human race, thinks we are slave insects, and wants to leave the planet they will be free to do that. They are not free to take others with them who love life, love their bodies, want to be here, and are going to stay.
So, I heard Ben’s little sarcastic whisper at the end of his post today about the sun. I know very well that guys have a psychological preference for anything that is BIG and Blows up because of their male physiology in the Blue Monkey, Yellow Star region, but what is big and can micronova or supernova doesn’t mean it’s the RULER of the LOCAL Universe. Most of the time the sun isn’t blowing up. It’s just nurturing all Life.
One-half of the body pulses the male energy and one-half pulses the female energy. The Yellow sun tribe initiates KARMA on the right and the Blue Storm tribe receives the crowning DHARMA on the left. The yellow sun tribe is in charge of initiating the male principle and WHITE DOG from the LEFT FOOT going up initiates the female receptive energy coalescing in the sub-stop codon that balances our brain, TRYPTOPHAN or Blue storm. The whole time they are weaving bilateral or binary ∞∞∞∞∞∞
The measurement of what is finished on the karmic side; Stop Codon, Cysteine, Glycine, Alanine, Valine, Serine, Threonine, Isoleucine, Leucine, and Methionine, moves to refinement to teach a lesson as;
Aspartic Acid (the female teaches love and loyalty), Asparagine, Glutamic Acid (we birth humans), Glutamine (big muscles), Lysine, Arginine, Histidine, Phenylalanine, Tyrosine, and Tryptophan.
Go ahead with your various Novas on the karmic side. On the dharmic side, we sit in love and loyalty, make humans and all good things, and go to sleep during a rainstorm. But what use is that if humans are just going to be blown up by a Supernova? Life and death. The two exist next to each other, don’t they? Is it ironic that the female receptive left side is SOLAR-prophetic? No, because the Sun is our mother. She birthed ALL LIFE and all of the planets. The right male side is GALACTIC-KARMIC. Karma comes through the male from Galactic Center and goes directly to the sun for the planets to parse out and teach via the kin.
https://cosmosmagazine.com/space/astrophysics/the-micronova-small-but-explosive/
What is the Meaning of Tzolk’in
Tzolkin is literally translated as “count of days” and it is a Mayan word.
Definition of tzolkin
: a period of 260 days constituting a complete cycle of all the permutations of 20-day names with the numbers 1 to 13 that constitutes the Maya sacred year.
It sprockets exactly with Earth’s 365-day solar year and the 64 Hexagram I Ching. The IChing and the 65 Harmonic Tzolkin also sprocket exactly and can be seen in my book “Time is DNA”
Since the Tzolkin is the count of days and the count of kin, kin has two meanings that are equivalent. A kin is a person and a 24-hour day that is governed by one Mayan Tribe that is an archetype for an amino acid glycoprotein. Since a person is made of trillions of DNA molecules, it follows that for humans, “Time is DNA.” We are time itself. Because we can control our own minds and bodies we can control our time.
Lisa T.
Scientists Have Finished Sequencing the Human Genome. Again. – ExtremeTech
“Scientists Have Finished Sequencing the Human Genome. Again. – ExtremeTech” https://www.extremetech.com/extreme/333647-scientists-have-finished-sequencing-the-human-genome-again
No, they haven’t. They’ve hardly begun.
They say “again”…because they keep making the same mistakes over and over because of their dogma and ego and never change their premise. It’s insane which is why sickcare is insane. Of course, they would lose their funding if they departed from their unimaginative narrative.
They don’t understand the body. They treat us like a side of beef, a car, or a robot. They wish we were robots which is totally creepy. No thanks.
The genome is sequenced by the Tzolkin and it is precise. They use nucleotide AAA in the article as an example which is pretty straightforward in the harmonic because it’s HF1 and HF65 as the inverse, it’s not a G.A.P. kin and doesn’t function in the binary triplet configuration nor is it an omega or alpha point.
AAA is Lysine-White Wizard timelessness. The harmonic consists of:
- 1Cysteine, 1Tyrosine, 1Cysteine, 1Asparagine, 13 Stop Codon, and then for sequencing you can spin that out to the tRNA gateway for 1 Tyrosine, 1 Cysteine, 1Asparagine, and 13 Stop Codon so you have a line of 25 molecules in total just for the first one.
- 2Glycine, 2Phenylanine, 2Lysine, 2Glutamic Acid, 12 Tryptophan and spin that tRNA out so that you have 25 molecules.
- Then do that again for the third and fourth gateways and you have 100 molecules to sequence in precise order and direction according to Tzolkonics JUST for AAA.
But you have to figure in the inverse harmonic also because of polarity, positive and negative movement of the electrons and proton. So add in HF65 which is TTT-Phenylalanine and you have 100 more molecules. That’s 200 amino acid molecules to analyze and that’s not even all the patterns!
I haven’t fully figured out their relevance yet but there are far more cosmic patterns to be found because WE are cosmic. And, given that TIME is DNA we need the physicists to chime in. But the microbiologists are very far from where I am. We’re barely in the same neighborhood, except for Dr. Chavez. He totally understood what I was doing and complimented me on it. It would be amazing if even posthumously they figure out what I am doing because they are 3D clenched. I’ll probably be dead before they get it. Fine.
KRSFIEDLLFNKV-The Covid19 Virus general sequence used to make a vaccine…maybe.
The letters in the title are the single letters that represent the dominant amino acids in the SARS- CV2 virus.We know from Dr. Chavez that the CV2 signature is artificial but the NIH scientists are looking at the natural zoonotic one. I don’t think they are the same. NIH may be lying.
This might be false information again to throw everyone off the track. Remember, they’ve been working on the artificial signature since 2009 and the real questions will be, once the artificial signature is analyzed in light of the Tzolkin how will the vaccine mRNA sequence they have manufactured interact with it?
Since it’s mRNA it can keep mutating. They address that in the link above but not to my satisfaction. This is messenger RNA which is part of the initiation of the RNA sequence.
Q: What determines the mRNA codon?
A: The cellular discussion between the ribosome and the amino acid through the tRNA or transfer RNA which is the Tzolkin Themeplex. They have no clue. My book isn’t out yet.
The tRNA looks like the Tzolkin themeplex and I go into it extensively in my book.
This is 4Leucine∞4Asparigine, 4Valine, 4Tyrosine, 10Glutamine as a tRNA molecule in my opinion. The 3 dimensional image above of the double helix corresponds exactly to the binary triplet configuration I have figured out and have made a huge complex document I’m currently getting into my book that will explain how the G.A.P. kin of the Tzolkin form the ladders that likely are the ribosomes and the double helix may be the sugar backbone. I’m not sure yet. But it all pulses exactly off of the mother’s DNA in the double helix as the Hidden Wisdom or subconscious mind everyday.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151553/
It boils down to this. Note that there are 13 Amino Acids in the Sequence the NIH gives us. If only the scientists understood the application of the 13 Tones of Creation it would revolutionize genetics.
I’m breaking down the sequence from the TITLE above
- White Wizard is K or Lysine – 1st appearance
- Blue Eagle is R or Arginine
- Red Serpent is S or Serine
- Red Earth is F or Phenylalanine
- Blue Hand is I or Isoleucine These two
- Yellow Human is E or Glutamic Acid are analog
- White Dog is D or Aspartic Acid
- Yellow Star is L or Leucine
- Yellow Star is L or Leucine
- Red Earth is F or Phenylalanine
- Blue Monkey is N or Asparagine
- White Wizard is L or Lysine—Last appearance
- Yellow Seed is V or Valine
It turns out this sequence is found in all zoonotic origin coronaviruses and it is very bare bones, no start or stop codons nor the rest of the 20 amino acids.
Zoonotic means we evolved from animals and ARE animals. This is no big news. The big news that they are not specking out is the artificial sequence which I already have. What is the agenda behind the creation of the artificial signature?
Note that the sequence begins with the White Wizard and Ends at #12 with the White Wizard and then is SEEDED into the ground via Valine or the Yellow Seed Tribe.
I may add more to this or I may not. The link above is very long and involved but I’m not sure I trust it.
Lisa T.
Time Innovation: David Wilcock Did a Presentation on Densities on GAIA
“Time can be moved through the ZERO POINT between polarities.
David Wilcock quoting Professor Simon Shnoll
I just saw this in my notebook. That applies directly to Proline as ZERO in the Sidechain as itself, tryptophan (19) or the Stop Codon (20). Is Proline the zero point in the binary triplet configuration? Is it the pivot point between the polarity reversals in the Tzolkin?
The movement between polarities, positive and negative or protons and electrons happens in the middle of the Tzolkin or the Zone of Transformation, specifically on the G.A.P. kin
©Lisa K. Townsend
Don’t steal my ideas or your karma will be prolific.
Russian Discovery Challenges Existence of ‘Absolute Time’
by Jonathan Tennenbaum
(Full text of article from summer 2000 21st Century) |Russian scientists discover unexpected regularities in radioactive decay, linked to astronomical cycles
“Two years ago, nearly unnoticed in the West, the Russian biophysicist S.E. Shnoll published a paper in the prominent Russian physics journal Uspekhi Fisicheskikh Nauk1 summing up the results of more than three decades of investigations of anomalous statistical regularities in a wide range of physical, chemical, and biological processes, from radioactive decay to the rates of biochemical reactions.
The evidence points unambiguously to the existence of a previously unknown relationship between fluctuations in the rates of radioactive and other processes in the laboratory, and major astronomical cycles, including the day, month, and year. The implication is, that many phenomena which until now have been regarded as purely statistical in character—such as the distribution of fluctuations in the momentary rates of radioactivity measured in a sample—are somehow controlled or at least strongly influenced by an astrophysical factor, which varies in time in the same way at all points on the Earth.
Vladimir Voeikov, a colleague of Shnoll, comments in the Spring 2000 issue of 21st Century: “Shnoll’s work shows that time is heterogeneous. It is not a Newtonian time. Each moment in time is different from another, and this can be seen in any physical process that you study.”
Albert Einstein, who rejected claims by Niels Bohr and others that the fundamental microphysical processes are essentially, irreducibly random in character, liked to say that “God does not play dice.” Einstein and others pointed to the arbitrary nature of Bohr’s argument: Just because physicists in Bohr’s time could not penetrate beyond the apparent randomness of radioactive decay and other microscopic processes, to find a deeper lawfulness and regularity underlying such processes, does not mean that science is doomed to remain in that state of ignorance forever!
By demonstrating the existence of a universal, astronomical factor influencing the fine structure of supposedly random fluctuations, Shnoll et al. have opened up an entirely new field of scientific investigation which is not supposed to exist, according to Bohr.”
This sounds like TIME SCIENCE to me. Fancy that.
About TSR; Time Science Research
My work is based on 30+ years of TSR or Time Science Research that I’ve conducted by following and logging daily synchronicity in the Tzolkin. In my case it’s the Dream-spell book and then as I got into the amino acid assays it was a notebook journal interspersed with brainstorming.
I was reading the whole time as well. Authors who influence me are Jose Arguelles and most of his books, David Bohm, physicist, C.J. Jung, psychologist, Rupert Sheldrake, Biologist, Dr. Chavez, Molecular Biologist, Corey Goode, E.T. contactee and author, GAIA interviews with David Wilcock and Emery Smith, and more. All men I’m sorry to say, but the sciences tend to shut the door on very intelligent, intuitive women and men actually. They like goose-stepping humans to the institutions narrative. I don’t have that capacity and neither do thousands of creative thinkers.
The purpose of my book is to drop a pebble in the pond toward ending the current false healthcare paradigm that lies to us about our bodies, and about who we are, and scripts a narrative for the greatest profit for Big Pharma and high tech surgery that is usually not needed. They are good at marketing to patient’s egos, ignorance about their body, and fear.
My goal is species empowerment and self-healing through fact, particularly humans, but since all stellar species share our DNA, all species empowerment. I agree with Dr. Stephen Greer that we need peace in space and to understand the unified field of consciousness or the cosmic web as opposed to politics and commerce dominating our behavior and choices in the local universe. I realize some find universal peace idealistic and that’s fine. I’m not changing. I believe 100% in the power of the human soul, fully in the body as we’ve been taught, and I believe Science can be cleaned up on that score. It may take awhile though because of the money control instead of rational thought.
I say that because of who we are as entities based on what I see in the Tzolkin and have experienced as far as synchronicity and spirituality in my work for 30 years. I’ve had my hands on thousands of patients manually and energetically with Reiki for 23 years. We are children of God, not just children of birth or our E.T. family, and co-creators with Life. We belong to ourselves and we can control ourselves, ourselves in cooperation with each other and friendly E.T.
The E.T. are children of God as well and need to be shown this by humans who have something to share on a soul level. Love and peace needs to reign in the universe, not war, ego, and money. It’s been made clear that 98% of stellar species hold humans in high regard, even like royalty, but dark actor elite humans do not and have betrayed our species for millennia in favor or Reptilian A.I. and false power. We are slave scum to them. I disagree that tech is just a tool. It’s far inferior to the inherent power of the real intelligence of the body. We need to clean up that mess that has caused mountains of suffering for humans who’ve been programmed to believe they are nothing and weak.
This book is very heavy on analytical tables that may or may not be enjoyed by the civilian and may even confuse scientists. They are complicated. I’m doing my best to hook in the patterns I’ve found to the irrefutable facts that are common knowledge such as the 11.3 year Sun Cycle, the 20 amino acids that are the building blocks of life, the way the amino acids relate to one another in the same way as the archetypes, archeological facts about the Maya, Historical facts about the Chinese I Ching as the basis of our computers, facts about binary code and then hooking that to the multidimensional facts, and the way our tRNA moves in the Tzolkin Theme-plex. There is more but I will do my best to bring them along from their failed 3D clenching into the fold. I know I’ll have to patient and tolerant but I will not be disrespected…ever. I will find a way to talk about this to get their attention and peak their interest when I’m done writing.
But I have other sections and analysis that will bring it together for you. It is a meta-genetic order of analysis based on the hypothesis that the organization of the Tzolkin illuminates the evolution of the tRNA in all living cells, especially human amino acids. Our amino acid building blocks that make us visible and seemingly dense are time, spinning at 40,000 mps because of our consciousness and intention. We appear to be still because our ELM and gravity in our bodies is moving that fast. The Source is our Soul which A.I. will never have. They have the binary 0’s and 1’s in their system but so do we. It’s part of the Binary Triplet Configuration which is the foundation pattern for all life. It’s in the book.
We have the Tzolkin programming because we have blood and consciousness. A.I. will never have it because they don’t have blood. Humans cannot manufacture real blood. Blood is QI of which the Chinese are masters. Go ahead and try. You will be stopped or fail. We have ONE creator and we are born through our Mother’s DNA. That is strongly in the Tzolkin and in the genetic code itself. The female is the origin of life and the Reptilian and A.I. want that stopped as do the Deep State.
The physicists have proven that we are 99% empty space by analyzing the nucleus of the atom. We are time and conscious mind in third density. It’s electromagnetic force, gravity, and more.
When I started this project I imagined I might see a clue about how our proteins folded which has hung up scientists for forty years. I found more than I bargained for. It became clear to me by merging diverse streams of data from esteemed scientists and my own data, that in fact, DNA is Time itself. One strand of the double helix absorbs and communicates past to present from the cosmic web while the other does the same with future to present.
This action is 100% active all the time in the billions of cells of ALL LIVING THINGS causing multidimensional evolution and as Rupert Sheldrake says, “morphogenetic fields” or the presence of the past. He is correct, but I don’t think he saw the future in the genetic code. I have. Sheldrake is Red 13 Cosmic Dragon, today’s theme-plex so that is a great synchronicity that I’m talking about him today. He is a great man and contributed much and been maligned much by the narrative. Par for the maverick course.
I have the math and I explain it in depth in the book. Life is conscious and connected in a unified field that vibrates with every other living thing and it’s infinite and eventually timeless at the higher densities. However, we vibrate in all densities at the same time now IN OUR BODIES and can access the information with different mindsets in meditation or in our dream-state. Humans are a great species and we will not be stopped by rogue entities, other E.T., OR told what to do by the GFW (Galactic Federation of Worlds). I respect them but we have Free Will. Yellow Human! is about Free Will and Corey Goode is Yellow 7 Resonant Human. We shall see what transpires there. I have faith that humans will rise to the occasion and have plenty to contribute to Life in the Cosmos. We just have to cooperate and love ourselves and each other.
Peace,
Lisa T., Red 13 Cosmic Skywalker
Wednesday-Daily Reading; If You Can Define Something It’s Possible to be Influential
But everyone has free will so no one gets their way all the time even if they are correct. That’s Earth. Only certain people are allowed to define things and get any attention for defining it and in no way does it have to be accurate these days. That’s politics and it’s usually incorrect on the facts. It just has to blasted all of over MSM which programs people’s minds because they don’t know how to or won’t program their own minds. But you can define things for yourself in your vortex and watch your personal life and body change even if no one else is paying attention. Our minds influence our bodies more than anyone else by default. Realize this and it will repel people from you who refuse to take responsibility for their health and their body as human beings. It’s separating people right now in fact. So be it. Birds of a feather flock together.
It’s unlikely that most people will be influential. That’s not lost on me. Fear, ignorance and negativity still rule the narrative because disclosure has not completely taken hold yet, but I do believe it’s changing slowly. The facts are out there due to Corey Goode, Stephen Greer, David Wilcock. and others. What has really been lost is the elegance of the Guide Power; Yellow Star. Creating elegance gives me a reason to keep writing. People who are gracious and graceful are in short supply. I encourage you to follow the guide power in a world that thinks ugly is sexy.
Most humans won’t speak up if normally they’ve leaned a certain way on things socially but their silent buying habits and behavior will change. Those that pay attention can see it. Your intuition can feel it as well.
Body Holon
- Tone 4 pulses to the left wrist joint.
- Theme is 4Glutamic Acid or Yellow 4 Self-Existing Human. This pulses to the left abdomen.
- Analog is 4Isoleucine or Blue 4 Self-Existing Hand. This pulses to the right abdomen.
- Guide Power is 4Leucine or Yellow 4 Self-Existing Star. This pulses to the right low back, buttock, genitals and thigh.
- Antipode is 4Glycine or White 4 Self-Existing Wind. This pulses to the right side of the face nose to chin.
- Hidden Wisdom is 10Methionine or Red 10 Planetary Moon. This pulses to the right leg and foot.
- 5GForce is 10Leucine or Yellow 10 Planetary Star. This pulses to same area as the Guide Power.
Earth Holon
Yellow Human is a Core kin pulsing at the heart of the planet whose job it is to transduce. It’s located at the Equator°—105°W. It’s west of the Galapagos Islands off the coast of Equador.
Interplanetary Holon
Earth is the mediating planet today. Moon is in Virgo. The Sun is trine Neptune. Yellow Human sits on the female side of the body, solar-prophetic Outbreath. This is future to present timeline. Being able to see part of the future and create it is prophetic.
A NEW 13:20 Narrative to Secure Human Freedom For Earth
We no longer trust or need politics, religion, wrong science or government controlled by men to secure the freedoms and power that are inherent in our minds and bodies. Let it be so and go your way.
“The Thirteen Moon calendar is an evolutionary tool to assist humanity in the unprecedented act of uniting itself on one issue central to its complete well-being: TIME.
The harmonic convergence of humanity on this one issue, combined with the inescapable order, perfection and simplicity of following the 13 Moon calendar will lift the species as a simultaneous whole into the galactic timing frequency of 13:20.”
José Argüelles/Valum Votan, The Call of Pacal Votan
We attest that we, the 13:20 Kin of the 4 Color Tribes and 5 Earth Families, which includes every single person on Planet Earth from every single culture, hold these Values to Be SELF-EXISTENT beyond politics, religion, or government;
- We Inform the flowering of humanity and Earth
- We remember the elegance of LIFE
- We formulate free will for ourselves, not needing authoritarian permission
- When we express ourselves, we seek to do so intelligently, all the time
- We Self-Regulate. We do not seek it outside of our bodies as we acknowledge that our bodies hold TIME and ETERNITY in every cell of our bodies as taught to us by the Maya.
The 13 Tones of Creation;
- Magnetic; Acknowledge FORM or 3D on Earth
- Polar; Acknowledge INTEGRITY in all of our dealings to stabilize
- Electric; Acknowledge COOPERATION within diversity
- Self-Existing; Acknowledge SERVICE to the community
- Overtone; Acknowledge ATTUNEMENT of the human soul via art
- Rhythmic; Acknowledge LIBERATION in all it’s forms
- Resonant; Acknowledge CHALLENGE for our growth and evolution
- Galactic; Acknowledge EQUALITY of value for all species
- Solar; Acknowledge MANIFESTATION in the hologram via our Great Star
- Planetary; Acknowledge PURPOSE for each kin
- Spectral; Acknowledge RADIANCE of each kin
- Crystal; Acknowledge INTENTION of each kin
- Cosmic; Acknowledge COSMIC RIGHTS, existence, awareness, and Universal Law extended to each kin
Throughout the 260-day-cycle sprocket with the 365-day Solar year, we keep a MINDSET of ACTION in each of the 65, 4-kin harmonics in the Tzolkin. This is how we use our time, illuminated by the Harmonic in which we were born every day, with an overlay of our actions for one we happen to be in currently. 65 x 4days = 260-day-cycle. As things spins within the 365 day solar-3D year it raises the frequency by 5 to bring in the bring in 5th density gradually. That occurs through the 13 full moon cycles each solar year. 13 x 28 days = 364. In essence, through the DNA of our mothers bodies. It’s in the sequences as the Loom of the 13 Moons, the DNA double helix woven by our Mother’s in utero.
- HF1-Inform the flowering of form (manifest a body in the holographic Matrix)
- HF2-Remember the elegance of integrity
- HF3-Formulate the free will of cooperation
- HF4-Express the intelligence of service
- HF5-Self-Regulate the Universal Fire of Attunement
- HF6-Inform the flowering of Liberation
- HF7-Remember the elegance of challenge (Be a good sport)
- HF8-Formulate the free will of equality
- HF9-Express the intelligence of manifestation (It’s good to be in physical-NO GUILT)
- HF10-Self-regulate the universal fire of purpose
- HF11-Inform the flowering of radiance
- HF12-Remember the elegance of intention
- HF13-Formulate the free will of presence (Just be yourself)
- HF14-Express the intelligence of form
- HF15-Self-regulate the universal fire of integrity
- HF16-Inform the flowering of cooperation
- HF17-Remember the elegance of service
- HF18-Formulate the free will of attunement
- HF19-Express the intelligence of liberation
- HF20 Self-regulate the universal fire of challenge
- HF21-Inform the flowering of equality
- HF22-Remember the elegance of manifestation
- HF23-Formulate the free will of purpose
- HF24-Express the intelligence of radiance
- HF25-Self-regulate the universal fire of intention
- HF26-Inform the flowering of presence
- HF27-Remember the elegance of form
- HF28-Formulate the free will of integrity
- HF29-Express the intelligence of cooperation
- HF30-Self-regulate the universal fire of service
- HF31-Inform the flowering of attunement
- HF32-Remember the elegance of liberation
- HF33-Formulate the free will of challenge
- HF34-Express the intelligence of equality
- HF35-Self-regulate the universal fire of manifestation
- HF36-Inform the flowering of purpose
- HF37-Remember the elegance of radiance
- HF38-Formulate the free will of intention
- HF39-Express the intelligence of presence
- HF40-Self-regulate the universal fire of form
- HF41-Inform the flowering of integrity
- HF42-Remember the elegance of cooperation
- HF43-Formulate the free will of service
- HF44-Express the intelligence of attunement
- HF45-Self-regulate the universal fire of liberation
- HF46-Inform the flowering of challenge
- HF47-Remember the elegance of equality (We are currently in this one)
- HF48-Formulate the free will of manifestation
- HF49-Express the intelligence of purpose
- HF50-Self-regulate the universal fire of radiance
- HF51-Inform the flowering of intention
- HF52-Remember the elegance of presence
- HF53-Formulate the free will of form
- HF54-Express the intelligence of integrity
- HF55-Self-regulate universal fire of cooperation
- HF56-Inform the flowering of service
- HF57-Remember the elegance of attunement
- HF58-Formulate the free will of liberation
- HF59-Express the intelligence of challenge
- HF60-Self-regulate the universal fire of equality
- HF61-Inform the flowering of manifestation
- HF62-Remember the elegance of purpose
- HF63-Formulate the free will of radiance
- HF64-Express the intelligence of intention
- HF65-Self-regulate the universal fire of presence
Work on Earth is Complete
Saturday-Earth Ascending Map 3
Look at the Center Column of the Tzolkin on the image below his video. We ARE IN THE CENTRAL CHANNEL, 4 kin down on the Tzolkin. This is the space that makes possible the transformational dynamic of the the crossover polarity created by the binary triplet configuration. THIS is the context within which his video subject exists.
No 3D clenching. We live in a holographic matrix where as a collective we affect the astronomical and geological movements on the planet with the power of our GROUP MIND.
The History of Harmonic Convergence
Why Does the Galaxy Matter to Us on Earth?
“The galaxy and galactic things figure prominently in the Mayan Tzolkonics. The Milky Way galaxy is the context within which all Life and thus all DNA lives in it’s myriad forms but that’s just the beginning”
The Universal context within which all Life exists is immense and beyond our human imagination but I won’t let that stop me. Today we are on White 8 Galactic Mirror so it is now time to take a look at much of what is beyond human knowledge that is not shared by our larger culture. The Urantia Book is one such thing and I’ll do my best to nutshell this particular piece.
Our Milky Way Galaxy is the central nucleus of our Superuniverse Orvonton. It’s the seventh superuniverse. Orvonton is south of the Milky Way Galaxy and Earth and it are in the southeast sector of Orvonton on the outside edge. We’re edgy, maybe even leading edge. Our local neighborhood universe on the southeast edge or Orvonton is Nebadon. The local system in Nebadon in which we reside is Satania, I suppose named for the once highly regarded and ever trusted angel of light, Satan. Please note that now he is regarded as the epitome of dark. Even in the Universe, people aren’t too big to fail.
That all changed and there are multiple stories of the Great War in Heaven in every culture. There is one in the Urantia Book and it’s pretty awful. I’m not going into that now. We’re sort of going through it ON EARTH right now and are at the tail end of what the benevolent ancestors watching over us are going to allow. Humanity is held like a babe in it’s mother’s arms. We are very guarded and cared for despite how other humans feel about each other. The Universe does not regard us lowly. We are held in high regard and our evolution means EVERYTHING to our watchers, as human children are x 100.
The Master Universe encompasses all of material creation. It includes the central universe of Havona (Heaven), the seven superuniverses and the four uninhabited outer space levels which revolve alternately clockwise and counterclockwise around Havona. In outer space millions of new galaxies are in the process of formation. The first outer space level is about 500,000 light years beyond the periphery of the Grand Universe.
That’s just a nutshell of the context of our galaxy. In the order of things, The Tzolkin, The Network Grid, galactic energy is about modeling integrity and harmonizing. White Mirror reflects Order and Endlessness which is why I brought the Urantia Book into the mix today. I’ve read the whole thing over a thirty year period and pick it up often and read it again.
If you’re interested in the details of the Lucifer rebellion it’s on pages 601-620. If you don’t have the book it’s also online. Lucifer and Satan are apostate princes and I do believe their mischief is at it’s end now, as of a couple days ago. It says they fought against the Dragon which is likely synonymous with the Red Dragon Tribe, The Dragon Family of China and The Draco E.T. who were just recently routed from the planet by the Pleiadians. The Tzolkin teaches all of that history and the DNA is all in there. Earth is a hodge-podge, a pluralistic fertile pool if you will and now we’re trying to harmonize all of it.
Protected: Searching for A Universal New Year: The relevance of August 13th. By Raul Grajeda
Protected: Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon-Ed Level Advanced
Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon
For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.
Here are the sequences of Covid19
As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.
I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.
Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!
The main analyzed regions
Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.
AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC
See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220
TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT
See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:
TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA
Protected: Time Innovation: Epigenetics-The Facts of Evolution Overstep Fate and Destiny
The Facts of Evolution Overstep Fate and Destiny
I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.
All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.
On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.
However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.
But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.
Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.
Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.
The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.
Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.
Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.
The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.
No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.
MOLECULAR LINE-UP
The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.
Set Your Intentions Daily or You’ll Be Programmed By Outside Forces and Media
I have to say, no matter what malarky is happening around me in human society I’m almost always at a 1 on the upward spiral. I don’t listen to or follow humans. Daily, I work with the universe and that’s how it’s always been for me. Maybe I’m a humanoid. I don’t know. We’re all just people evolving. The downward spiral is delusional lying to yourself. None of that is real. But I’ve learned people have reasons for sitting in shadow and I ABSOLUTELY accept it. Maybe it’s creative for them! There is no judgment and the universe watches over everyone.
The mental programming that’s going on right now is far more dangerous than CV2. I saw the most sinister, propaganda article by Google yesterday that stated that if everyone “cares” about one another by wearing a mask, CV2 will disappear. WOW! None of that is true and the experts will tell you that. Viruses never go away they just mutate!
The powers that be continue to play on natural human good intentions and good will to suck the life out of us for their nefarious purposes which would blow everyone’s mind if you knew the truth. Let’s just say we live in an inhabited universe and some humans have made alliances that are better for them than us.
Once a virus is born it never goes away. It just keeps mutating until it turns into DNA over a long period of time. By then it’s not very potent and doesn’t mutate on it’s own like the RNA retroviruses. And it’s ever so easy to get into a host since it’s microscopic. Nothing can stop it. They won’t tell you that. IF YOU BREATHE, and everyone has to breathe or you’d be dead, it’s already in you and just sitting there like every other virus on the planet eating the bacteria in your body that you no longer need. It’s no big deal as long as you’re chill and are happy.
That gets to the point of the today’s title. You’ve got to be inward and focus on controlling your own mind. We all came to this planet to check out the digs, to explore. Red 9 Skywalker is all about pulsing to explore and that is today’s theme.
- The analog support is White 9 Worldbridger which realizes intention and pulses opportunity
- The Guide Power is Red 9 Moon which realizes purification and pulses flowing, universal water.
- The Antipode is Blue 9 Night which pulses dreams and intuition and realizes abundance
- The Hidden Wisdom is Yellow 5 Star which pulses beauty and art and realizes elegance.
With the New Moon in Cancer today and all of this new cosmic energy we can dream up a more beautiful, creative space for ourselves where we live. I was cleaning like crazy this morning and have new plans for my office to please my patients and myself. There is always room for improvement! The Moon is the mediating planet for the Guide Power, Red Moon.
MOLECULAR LINE-UP
Protected: Essay: Knowing and Admitting Your Feelings About a Situation is Really Important
Bring Light Into the Body to Survive the Mental Darkness of People Obeying Indolence
DRINK LOTS OF WATER-GOOD WATER!
The tetrahedron is the 4 sided geometrical shape we know as a pyramid. It has one unified point in the center and 5 vertices. Very synchronistically, a WATER molecule is a Tetrahedron. When you drink water you’re drinking microscopic pyramids. Every one of our amino acid proteins that make up every single cell of DNA in our bodies has hydrogen and the Tzolkin Harmonic regulates their movement as time which is DNA. It’s one of the main 5 molecules that compose all life. Hydrogen is the main ingredient in water. Hydrogen is literally called the WATER GENE. It’s the main gene that makes up our genes!
We know the origin of oxygen on the planet was the first algae that grew here but what is the origin of water? It is our ancient ancestors, the Life Carriers. They have the hydrogen gene and if the atmosphere is ready to grow hydrogen they bring it to the planet. Like most of our amino acids, they found hydrogen IN THE STARS. Stars are made of very hot gas. This gas is mostly hydrogen and helium, which are the two lightest elements. Stars shine by burning hydrogen into helium in their cores, and later in their lives create heavier elements.
TODAY IS Yellow 4 Star so it’s very synchronistic that I found this. From planet to planet, pyramids can be found in our local system. They seem to be structures that are a type of LAB to ground life force on a planet; life we all share. Maybe they are water labs. I haven’t read up on the pyramids yet but the Egyptians were partial to pyramids as well as the Maya and they were from our beloved Pleiadean star system which is closely aligned with VENUS, our mediating planet today.
The 5GForce is Yellow 10 Human which lends credence to the idea that bringing water to a planet from the hydrogen made from stars helps humans evolve.
“I perfect in order to influence. Producing wisdom I seal the process of free will with the planetary tone of manifestation. I am guided by the power of universal fire. I am a galactic activation portal. Enter me.“-The Dreamspell
MOLECULAR LINEUP
- Theme is Yellow Star-Leucine
- Analog is Blue Monkey-Asparagine
- Guide Power is Yellow Seed-Valine
- Antipode is White Mirror-Tyrosine
- Hidden Wisdom is Red Skywalker-Glutamine
Synchronicity is the Source of Consciousness 
You must be logged in to post a comment.