Jose Arguelles’s Teaching on Harmonic 33


Thursday, August 6, 2020

Kin 130 

Cosmic Love at the Heart of the Tzolkin!

From the Center, Galactic Source

Which is everywhere at once

May everything be known

as the light of mutual Love”

Prayer of the Seven Galactic Directions
By Jose and Lloydine Argüelles (Valum Votan & Bolon Ik)

https://wp.me/p83Oy1-dW

Happy Magic Flight of the White Mirror Wavespell at the center of the Tzolkin! Today, we transcend the 13-day Wavespell of Endlessness through the Power of Heart, which is coded by Kin 130 (Cosmic Dog), the manifestation of Cosmic Love! Exactly, Kin 130 = 13.10 (Tone 13, Seal 10 / Wavespell 10) and it contains the Power of 13 x 10 (Love) = 130.

Kin 130 sits at the Heart of the 13:20 Tzolkin Matrix and also at the Center of the Dreamspell Harmonic 33.

Kin 130 represents the Omega Point of the first half of the Tzolkin, while tomorrow’s Kin 131 is the Alpha Point of the second half of the Tzolkin. Today, we enter the Infinite Galactic Centre which is a portal to higher dimensional realms of consciousness.

Through the Power of 33, our spiritual umbilical cord is telepathically connected to the Hunab Ku, the Heart of the Galaxy. “Kuxan Suum: Literally the “Road to the Sky Leading to the Umbilical Cord of the Universe,” defines the invisible galactic life threads or fibers which connect both the individual and the planet, through the Sun, to the galactic core, Hunab Ku.”––Jose Argüelles. The Mayan Factor.

This Kin 130 marks the entrance into the first Tzolkin Heart of the current Magnetic Wizard Year, as well as it signals the conclusion of a timeless Crystal Hologram right at the Centre of the Harmonic 33. This multi-dimensional Model of Ascension was opened through the recent Transit of Mercury on 11.11.19 (11 November 2019), covering a 9-day period until 19 November. This 11:11:19:19 Hologram accurately inscribes the Solar Sequence of Ascension of the Crystal Prophecy, which demonstrated through the interaction of the 13:20, 11:11, 19:19 and the 33:33 matrix systems.

As we mentioned on this wavespell blog, for the Ancient Maya the mirrors were portals to the afterlife. The number 13 represented the “13 Heavens” that come after the journey of the dead through the “9 Underworlds” of Xibalba.

Exactly, the bearer of this Wavespell, Kin 118 (Magnetic Mirror) is equivalent to the Maya sign of 1 Etz’nab, which is the Ascension Code of King Pakal (Pacal Votan) in the Maya RealTime. 30:18:1:118

Alpha Birth 8 Ajaw (Kin 60) + Omega Death 6 Etznab (Kin 58)
= 1 Etznab (Kin 118) = Mirror Wavespell
In this way, Pakal entered commanding this wavespell in order to access the “13 Heavens” of Maya Cosmology on Kin 130 and transcend as Cosmic Love.

May everything be known as the light of mutual Love!
Ah Yum Hunab Ku Evam Maya E Ma Ho! All Hail the Harmony of Mind and Nature!

19 November 2019 ~ NS 1.32.5.5
Wavespell Blog: https://wp.me/p83Oy1-3RC
___________________________________________

KIN 130: White Cosmic Dog

I endure in order to love
Transcending loyalty
I seal the process of heart
With the cosmic tone of presence
I am guided by the power of timelessness

Harmonic 33: Lunar Process
Formulate Free Will of Challenge

* Journey:
– Tzolkin: Day 130. Mystic Column 7 of the Self-Existing Dragon.
– Wavespell of the White Mirror: Final Day 13.
– Cosmic Gate (Tone 13): Take Magic Flight!
– Blue Western Castle of Burning. Court of Magic.
– Galactic Season of the Sun: Yellow Fire. Power of Universal Fire.

• Kin Synthesis: 13 Dog
Solar Seal: Dog
– Action: Love
– Essence: Loyalty
– Power: Heart
Galactic Tone 13 = Cosmic
– Function: Presence
– Creative Power: Endure
– Action: Transcend

* Oracle:
– Guide: 13 Wizard (Kin 234)
– Analog: 13 Moon (Kin 169)
– Antipode: 13 Sun (Kin 260)
– Occult: 1 Monkey (Kin 131)

* Root Race:
– White Family of the White Root Race.
– The Refiners. Keynote: Spirit.
– White Members: Wind, WorldBridger, Dog, Wizard, Mirror

* Earth Family:
– Polar Family: Sound the Chromatics.
– Members: Yellow Sun, Red Serpent, White Dog, Blue Eagle.

* Chromatic Clan:
– White Truth Clan.
– Position: Crown. Action: Receive.

___________________________________________

Time Innovation: Synchronicity-Trinity was in Room 303. We are in Harmonic 33


Room 303 was a room within the Heart O’ The City Hotel from Mega City in the Matrix. It contained a hardline, and so was a location that red pills could use to safely escape from the Matrix. I don’t think hardlines actually exist by the way although you can encrypt your hard drive. Otherwise, anything that goes through our router can be spied on. The archetypes for the Red Pillers, Trinity and Neo, 303 and 101 are archetypes for the Tzolkin Matrix Harmonic 33. We enter that today.

The Matrix movies are a Hollywood hack of HF33 to attempt to turn earth I to an A.I Controlled machine planet. NOT GONNA HAPPEN. We are working on balancing both natural evolution and digital life but humans will never be machines.

Today is kin #129, Red 12 Moon which is about being dedicated to community, universal flow. We’re sealing the process of universal water with the crystal tone of cooperation. There is no energy support in the grid for DICTATORIAL egos so humans need to act on the freedom that is given them by universal forces and act accordingly. The dictator politicians will be swept away with no support. Ignore them.

The analog is White 12 Dog, the Guide Power is Red 12 Dragon, the antipode is Blue 12 Storm and the Hidden Wisdom is Yellow 2 Human. We are in the very center of the Tzolkin and this harmonic turns in on itself meaning it’s inverse is itself whereas, for example, HF1’s inverse is HF65, the first and last harmonic in the Tzolkin.

Crystal, community, Flow of Emotion.

This is the center of the binary triplet configuration that creates the DNA double helix spiral, radial polarity that is our DNA and Time itself. I believe it’s the doorway to Implicate order that David Bohm, physicist, speaks of in his work, “Wholeness and the Implicate Order”. The Implicate order is Galactic Center, where God is. You could think of this kin as the Door to the Spiritual Crystal temple where the collective gathers. It’s the universe and the temple is everywhere.

Tomorrow, kin 130 is the Trinity, 303, 33, The Father-Mother, Son-Daughter, and the Holy Spirit. The female is equal to the male in the Universe. Patriarchy on Earth is not in reality at all and has wreaked havoc. That is over now. Kin 130 is also the Omega point, the end point, White 13 Dog, Cosmic Love, Loyalty and Heart. Christ Consciousness.

The next kin, 131 is the Alpha point, Blue Monkey Wavespell 11, Power of Magic, the Dragon Genesis Complete as the Dragon Tribe, Red 1 Dragon began our evolution on Earth. Kin 131 is Blue 1 Monkey which is about unifying and creating.

The last kin of this harmonic is Yellow 2 Human, dualistic, stabilizing, 2 strand DNA humans. We polarized in order to influence. Polarization is not negative! It stabilizes wisdom and creates free will. We’re going through it right now. We have Red Pill and Blue Pill, Republican and Democrat, Right wing and Left wing, Lovers and Haters, Empowered and Victim, Independent and Dependent and the list can go on. At some point in our lives we have been on both sides. It depends on where we are in our personal lives. But we should not judge or abandon each other because we’re DIFFERENT. Polarization is challenging but by no means does politics DEFINE OUR SOULS. This is where we find ourselves today and I believe it’s because humans have given over control of their bodies to the system. Your body IS your soul and your mind. It’s time to take control of your body and mind for yourself and stop giving it over to everyone else and letting the sick care system hex you into oblivion with their bad magic.

Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon


Remember what ONE Tzolkin Harmonic Looks like? FOUR SQUARES = 4 DAYS or 4 KIN in the Harmonic code. There are 64, 4 kin Harmonics adding up to 260 days. In each KIN (a square) are 5 archetypes that I believe are actually tRNA molecules that CODE ALL AMINO ACIDS IN OUR LOCAL UNIVERSE. This is the Code of Life and I’m cracking it…I think. It needs to be run in the lab.

For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.

Here are the sequences of Covid19

As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.

I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.

Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!

The main analyzed regions

Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.

AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC

See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220

TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT

See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:

TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA

Red Galactic 8 Serpent Whose Mother is the Dragon


Daenerys Targaryen is a fictional character in George R.R. Martin’s A Song of Ice and Fire series of novels, as well as the television adaptation, Game of Thrones, in which she is portrayed by English actress Emilia Clarke. She is the Mother of Dragons and a great example of a Dragon Lady which in this case, is complimentary.

At this link you can find the secrets of the serpent kingdom according to the Maya. I’m guessing George R. Martin was familiar with the story of the Tzolkin, the 13 Moons, and the Maya because he heavily invoked it’s archetypes in his novels. The difference is the Maya are not fictional and neither is the Tzolkin or it’s synchronicity. It’s all very real.

https://www.ancientpages.com/2018/09/15/secrets-of-the-serpent-kingdom-revealed-on-maya-game-of-thrones-altar/

“According to Tomas Barrientos, co-director of excavations and investigations at the site, the altar depicts King Chak Took Ich’aak, La Corona’s ruler, “sitting and holding a scepter from which emerge two patron gods of the city.” (Corona means Crown and is the first word in Corona Virus. The virus is mostly affecting people’s heads and the brain. Synchronicity)

The 1.46-meter by 1.2-meter slab contains also a hieroglyphic Mayan inscription corresponding to May 12, 544. Based on this and other discoveries researchers have been able to  determine that King Chak Took Ich’aak also governed the nearby city of El Peru-Waka some 20 years later. Barrientos says these pieces of evidence show that the Kaanul dynasty, or Serpent Kingdom, developed a political movement in La Corona that allowed them to defeat their Tikal “arch rivals” in 562 and thereafter rule the Mayan lowlands in southeast Mesoamerica for two centuries.”

  • The Theme is Red 8 Serpent or galactic Serine
  • The analog is White 8 Wizard or galactic Lysine
  • The Guide Power is Red 8 Moon or galactic Methionine, the Start codon for amino acid sequences
  • The antipode is Blue 8 Eagle of galactic Arginine
  • The Hidden Wisdom is Yellow 6 Warrior or Rythmic Histidine

Red Serpent is the evolutionary child of Red Dragon. For some reason it lost its wings and legs or appendages. Red Serpent attributes are; survival, instinct, life-force passion, resourceful, sensual, extremist and charismatic. Mediating planet is Maldek for with it’s destruction, Pluto which rules Scorpio came into the picture.

Look at this synchronicity, which I have found with every Tzolkin archetype and their corresponding amino acid;

L-Serine. L-serine is an amino acid essential for the synthesis of phosphatidylserine, which is a component of the membrane of brain cells (i.e., neurons). It can be produced in the body, including the brain, but an external supply from the diet is essential in maintaining necessary levels.

The Dreamspell says we are by the Dragon born which is Tribe number 1. The by Tribe 5 we are at Red Serpent.

“To prepare for the magic, first serpent cast the wavespell of life force. For thirteen steps the life force climbed its way through the first quarter of the castle of burning.”

Competition Can Be Inspiring


I perked up when I heard military insider Emery Smith say, “Humans are egos.” That rang true. Today is Tone 5, the Overtone tone that is about commanding, radiance and empowerment. There is one thing every human wants and that’s personal power. If they don’t know how to self-generate it inside, which is Tone 4, they will project outside of themselves and try to pulse off of or vampire off of someone’s else’s energy to make themselves bigger or better in some way by competing. Or they will fain affinity when there might not really be much affinity to try to energy cord the person to suck energy from them. For some reason, humans compete more with each other gender wise than listening and vibing with the universe. Women compete more with women and men compete more with men.

Today is White 5 Wind which is mediated by Uranus. The attributes are communication, breath, and spirit. agile, divine breath, clever, multifaceted, inspiration to all, idealistic, mental, presence of truth, spiritual, and romantic. That’s all positive. Why is the antipode or challenge Yellow 5 Human? Why are humans a challenge to radiant empowerment? Because they compete and want to dominate more than they want to love. That’s ego. They don’t see themselves the way God sees them. That’s the definition of politics and why it does NO GOOD in the world. It’s a waste of time and drama. The attributes of Yellow Human are influence, wisdom, and free will. Humans use their influence and freewill mainly, to try to control and dominate others.

The Guide Power is White 5 Dog or Radiant Love and Loyalty, Heart. So in the Tzolkin, the energy line up and consequently the cellular DNA line-up is correct. How will that show itself in human behavior?

White 5 Wind is Divine breath and communication

If you improve something in your life or you reach a goal, get healthier or more radiant, the same gender so-called friends will SAY something positive and encouraging to you that is sincere. They will not act jealous or self-depricating, or self conscious low self-esteem about themselves. They will be happy for you. They will not call you names and hate on you, even jokingly. The “I’m so jealous I hate you” little comment. Or, “I can’t (or can) do this as well as you do!” They turn the focus to themselves and how weak they are. Watch your back!

This is my pet peeve with women. I don’t obey or follow humans as I’ve said before. I work very closely with my spirit guides, my intuition and the Universe. I am successful at anything I put my mind to and women and maybe one man compete with me. Their competition with me inspires them to do better which is good. Blue 9 Storm is the Hidden Wisdom. It is about catalyzing energy and self-generation so there you have it.

Most humans react or stare at each other on social media and in politics and then MIMIC or COMPETE to try to one up each other to be better than they were before. That’s not such a bad thing as long as they’re strangers. But it’s not loving with a friend. When a friend or sibling says something that’s competitive I know they don’t love me and it’s happened more often than not. As I type I can think of no less than 20 women and one man that either has competed or competes with me now. The funny thing is, they don’t want to hang out with me when I reach out to them. That clinches it. They feel too insecure around me. That’s not love. They aren’t the least bit concerned about what I need, don’t ask and don’t think there is anything I need because I don’t whine and I’m not dependent and insecure.

The 5GForce is White 9 Mirror, kin 178. This is the Writer’s Mantra;

” I pulse in order to reflect. Realizing order I seal the matrix of endlessness with the solar tone of intention I am guided by the power of timelessness.”

MOLECULAR LINE-UP

Tuesday. We are now in the Mystic Central Column


The Tzolkin Harmonic

Dragon energy is in our spines! It’s the source of our body grounding. The central column of the body is the CNS or cent e al nervous system. It co sists of the brain and spine which houses the spinal cord. It’s a dragon that needs to be tamed with focus in meditation so that we can become co-creators. This Dragon doesn’t project outward it projects inward; Tone 4, Self-Existing.

In the Tzolkin the central column is kin 121-140. Right in the center of the mystic column is Harmonic 33. That’s mystical also.

I’ve already done some work on it. HF 33 is kin 129, 130, 131, and 132. White 13 Dog is smack dab center and is kin 130; Cosmic Love, loyalty, enduring in order to love, it seals the process of heart with the presence of cosmic loyalty and love or who some people would call God or Source. It’s guided by timelessness or eternity.

This harmonic is it’s own INVERSE and that illuminates how our DNA proteins fold in every cell of our bodies. I use the coordinate 33:10:13:130 which incorporate the power of 5 and the reiteration of 13. You can see the preponderance of 3, 1, and 0 through it. The Trinity, Source and 0 are infinity or in Mayan MATH, exponential TIME. That’s eternity or the existence of multi-dimensional DNA forever. That’s us. 0=20 in the Tzolkin. 0 is Yellow Sun Tribe and 20 is the amino acid Proline. They are both STOP CODONS in our cells.

I know this doesn’t sound very scientific but actually it is. It is on the heart hinge, the thoracic spine generally and specifically, T7 and to some degree down to T10. The rear and front HEART chakras are controlled and aligned by Kin 130; White 13 Dog. Did you notice the anagram of dog? Spelled backward it’s god or God.

The DNA is a binary triplet radial polarized spiral some of the time. Actually it contorts in all different manner as it evolves and mutates to a great degree by us. Our choices and habits of thought, feeling and action have been proven to change our very powerful mitochondrial DNA which when charged up changes the oxygen and ATP levels available to our muscle tissue to burn energy (food). Regular aerobic movement is probably the most beneficial and spiritual activity you can do for your entire body, especially your heart and brain. I feel like a kid again after a good workout.

The mystic column is headed up by today’s Red 4 Dragon or Self-Existing primordial mother and blood memory, kin 121. Who is our primordial mother? The earth and the tribe of beings that seeded us here; The Red Dragon Tribe. In fact there is a Dragon Family in China that is revered as the founding family of all the Chinese much as the Reptilian Family was revered by the Europeans as the monarchy. The Reptilians are the ones pushing A.I. or artificial intelligence. In no way is A.I. good for humanity and I don’t support it at all.

Those days are over with the current Disclosure happening about the condoned pedophilia and incest of the elite headed up to a great degree by the these families. It’s Luciferian. None of this religion! It’s just part of Earth history and the vie for power over how things progress here. It’s a complicated story. Many are being arrested and our financial system is currently being rocked because the U.K. funded our Federal Reserve. And we all know the multiple layers of trouble with China right now. My point is, underlying the political trouble with Europe and China is America’s contracts and relationships with the E.T.’s, our cosmic ancestors.

The human race is safe and much of it has been quelled already. But our life on the surface of the earth doesn’t have to be this chaotic. Much has been kept from us about our ancestry and military tech that is supposed to used for all of humanity. We are highly valued in the Universe; loved even. But most humans don’t feel that way because of the greed of the elite and suppression of vast amounts of information. They are getting IN THE WAY of humans having a better life. No one knows what’s going to happen, but military insider reports say the Draco and the Reptilians are very real. They are E.T.’s and were here before us. Most E.T., animals and plants were here before us. The humans are fairly new here as an evolving species and we’ve been helped along by all the former. The Draco, Dragon Tribe ancestors have been routed for now. That is a recent occurrence.

  1. The Theme is Red 4 Dragon or 4 Cysteine
  2. The Analog is White 4 Mirror or 4 Tyrosine
  3. The Guide Power is Red 4 Earth or 4 Phenylalanine
  4. The Antipode is Blue 4 Monkey or 4 Asparagine
  5. The Hidden Wisdom is Yellow 10 Sun or 10 Stop Codon

Molecular Line-Up

The 5GForce is Blue 10 Storm or 10 Tryptophan which sometimes functions as a stop codon when there’s been a mutation.

Nucleotide UGA can be found in the mRNA of Cysteine/Red Dragon as mitochondrial human DNA Tryptophan, not a Stop Codon, when the human host willingly changes their own DNA via epigenetics. That is scientific fact. Our birth DNA does not control our destiny, it just gave us our bodies. After we’re born, we have the power to harness our own inner dragon and be whatever we want to be. But you have to focus and work at it.

Polarization. If We Know What We Don’t Want We Can Narrow the Field of What We Do Want


Tone 2, Polar/Lunar is about Dualism and polarization in order to stabilize. There is a mountain of polarization all around us right now; partisanship Pub and Dem, Mask-No Mask, Fearful vs. Confident, Truth vs. Lies, healthy vs. unhealthy and onward. Don’t we get bored with polarization? I do. But knowing what you don’t want helps you laser focus in on what you DO want so you can set your intentions more directly and accomplish something.

I’ve written extensively over ten years on this blog about using your feelings as road signs but not a map. The antipode today is Red 2 Moon, the Moon is Square Libra and the archetype for Libra is the Scales. Our challenge and gift today is to try to find a modicum of balance in our feelings.

The Goddess Justice or maybe Athena

There is the Goddess of Justice on the right. I love that she has the sword in her hand. She picked that up yesterday as an archetype of White Mirror. Yesterday was White 1 Mirror or magnetic discernment. Notice she has the blindfold on too so that she does not make decisions based on gender or cultural bias. That’s like music auditions for orchestras taking place behind a screen because professional orchestras are notorious for being all male. It’s very easy to observe the boy’s club in every profession showing that the men want to get away from the women so they can focus. Women are relegated to “a role” for men for that very reason. We are extremely distracting for them. The fact being that when a woman walks into a room of males, all the attention goes to her if she is the least bit attractive. Men are hard wired. Such is not the case with a a man walking into a room full of women. We’re looking but by no means are we distracted. Women are very able to focus and get our work done no matter what profession we work in.

Today is Blue 2 Storm whose attributes are catalyzing, Energy and Self-generation along with the the Tone 2 attributes. There is a Virgo feel or Mercurial feel to Blue Storm as well, maybe because Pluto is SO far away and has had it’s identity messed with lately. I don’t know if it’s back in the solar system club or not. Speaking of justice, I’m pretty sure that was all politics.

Astrological Synchronicity

The Moon continues its transit of Libra today, and we seek fairness and harmony. There can be some restlessness or competing ambitions and needs to manage. We can see a more sober side of Libra with the Moon’s square to Pluto and then Saturn this afternoon. This is in synchronicity with Blue Storm∞Yellow Sun having PLUTO as their mediating planet. The urge or need to socialize and connect with our relationship goals can seem to clash with our ambitions and responsibilities. A Jupiter-Neptune long-term transit perfects tomorrow, and we’re inclined to seek and find inspiration.” -Cafe Astrology

Jupiter and Neptune mediate Yellow Seed∞Blue Eagle and Red Dragon∞White Mirror. More likely this is karma related. Also, Red 2 Moon is the antipode today so the Libra Moon is square to that as well calling for a need to stabilize emotions.

MOLECULAR LINE-UP

  • Theme in the center is Blue 2 Storm-Tryptophan
  • Analog on the Right is Yellow 2 Sun-the Stop Codon
  • Guide Power above is Blue 2 Monkey-Asparagine
  • Antipode on the left is Red 2 Moon-Methionine the start codon
  • Hidden Wisdom below is White 12 Wind-Glycine
  • 5GForce is Red 12 Dragon or Cysteine

I see in our mediating Amino Acid Tryptophan (Blue Storm), the hexagram and pentagram of Saturn and Jupiter. That is a DNA FINGERPRINT in our cells because they helped us regroup and survive once we escaped to Earth as refugees post Maldek disaster. The proof of this disaster is the asteroid belt that is literally there today. How do we feel about the 12:60 intervention now?

We see the 12:60 intervention/control in our institutions of government and Church. Do we really still need those to control our dysfunction? Did our dysfunction cause the Maldek blow up? I think it did. It’s well known that many humans feel much more secure if they have an authority figure over them telling them what to do because they’re brains are not yet fully civilized. We see that playing out right now as we speak and I think all of this has been a test to see who is in control of themselves and who is not.

Once a majority of humans no longer need the control of 12:60 our sun will fully relay 13:20 to our planet, our original coordinate for earth. Don’t wait. Follow along with a 13:20 app today. They even have wall art/calendars if you prefer but the time is past to have your mind aligned with 13:20 so we can be done with this polarization and live unified amidst diversity.

Welcome

https://another-world.net

The Facts of Evolution Overstep Fate and Destiny


I’ve bothered to bring ancient wisdom and systems of organizing and seeding DNA on Earth down to the molecular level because of free will guiding evolution. The attribute of free will is manifested by the Yellow Human tribe. Up until now, evolution has either been esoteric and in the realm of New Age Religion or in the lab with the reductionist geneticists using Crispr to slice and dice our DNA.

All religions have been a step forward for humans except for the superstitious parts that require no critical thinking. Generally you have a prophet, a seer, a visionary and a teacher. The new age movement has plenty of those types and unfortunately there is usually some strong, intelligent woman behind the Kings throne to keep him socially cued in. I still see it everywhere in 2020 and she still has to be beautiful and hang on his arm. She is capable of being the leader, but even in the New Age religion, men are men. They are egos that need to try to get territory and dominate because generally speaking, they’re not as strong as women. We tend to dominate this planet, walk into a room even with our shirts on and the men’s mouths drop open. Women have tremendous power just by our physical presence. That’s not the effect men have on women but we are most definitely paying attention and appreciate beauty. Well, I am. I love the line on “Big Bang Theory” where Leslie Winkle says, “Come for the breasts, stay for the brains”. That’s gold. Most men don’t stay for female brains unless they have brains themselves but being men, they need to feel dominant so many times will pick a woman less intelligent than him. Smart women still end up alone much of the time no matter how they look.

On Earth, we still have a problem with the subconscious programming of gender roles seeded in us by our parents generation who went through tremendous trauma to survive the cabal and their nefarious lies and actions. It may take us a while to heal that. In that sense, the New Age religion has been no different.

However, now it’s time to seed a New Science that has at it’s foundation the intended oneness of Mind, Body, and Spirit. Our body IS our Mind and IS our spirit. There is no more degradation of the body, women, sex, and celibacy. We know synchronicity is real and that in the Matrix it’s not about coincidence, ever. Everything happens for a reason.

But today’s Theme, Red 13 Earth TRANSCENDS synchronicity which is an attribute of Tone 13. Cosmic kin transcend, have presence, and endure. We go past what is normally understood or seen and are therefore leaders for the people.

Cosmics have the patience of a great tree. We have enduring patience and perseverance.

Trees are archetypes for EVOLUTION. Red 13 Earth kin navigate the Matrix, transcending synchronicity in order to EVOLVE. The great lesson of this kin is that on Earth we have the power of birth, intelligence, freewill, and SEEDS. Yellow 1 Magnetic Seed in the Hidden Wisdom. All good things on earth come from seeds and we must respect and guard them well. Why? Because seeds are little DNA packets. They are time travelling pods and ensure the future of Earth and our progeny; animals and plants.

Given all of that, the edicts of control, fate, the gods, and destiny are cast out by Earth’s children. We create our own destiny. There is no fate or control of the gods as told to us in Greek myths and others. The Tzolkin doesn’t even control us; it just organizes the Matrix. Everyone’s intentions IN TIME have to coalesce in an orderly fashion or there would be more chaos than there already is.

The analog support is White 13 Wind. This is divine breath, God speaking through evolution. I’m down with that and I’m listening. The Guide Power is Red 13 Dragon, Rupert Sheldrake’s birth theme. He teaches morphic resonance. That melds perfectly with terrestrial evolution and divine inspiration.

Morphic resonance, Sheldrake says, is “the idea of mysterious telepathy-type interconnections between organisms and of collective memories within species” and accounts for phantom limbs, how dogs know when their owners are coming home, and how people know when someone is staring at them.

Sheldrake is inferring what Arguelles inferred all the time; DNA is Time.© There is Interconnection between a DNA organism and collective memories which are time, is the way I would say it. And it’s not mysterious. I have it figured out and I’m putting it in a database to be analyzed. There is rhyme and reason to it.

The antipode is Blue 13 Hand or ongoing healing. I swear I’ve been a healer in every lifetime from planet to planet. I could do it in my sleep. My hands are so attuned to the natural body I can’t fathom calling myself a healthcare worker and not touching the body. It’s so bizarre to me. The boundaries are in my mind. I wouldn’t dream of crossing pa physical boundary with a patient yet sometimes I feel they want me to given the tremendous dysfunction in our society with regard to the body.

No one touches anyone with kindness. When a bodyworker does touch them with kindness and excellent therapy, some are confused. It’s a travesty. The human body is OBJECTIFIED because of our psychotic sick care system and no one is educated about how their body actually works. The doctors aren’t even educated that well. If Church and State can keep you ignorant about the unlimited power of your body to heal, bring pleasure, and accomplish what you wish, they can control you. That has been the status quo and is even now with this planned virus event.

MOLECULAR LINE-UP

The bottom two, isoleucine (Blue Hand) and valine (Yellow Seed) are identical. The power of the Earth and it’s elements TO HEAL naturally is deeply seeded on Earth.

Dr. Chavez Brand New Data on Lab Analysis of the Covid19 Sequence. It’s Not Natural, Therefore a Real Vaccine Cannot be Made.


For the record, Dr. Chavez validates the work I’m doing in Time Science. He is a molecular biologist and works with DNA in the lab.

Fernando Castro-Chavez is with Lambert Dolphin.
abstract technology science concept DNA binary on hi tech blue background

9 hours ago

Whatever They Make and Market is  Either Culling or a Placebo. It’s Not Medicine.

Feel free to skim this. It’s very technical and is a series of quotes from papers by the fellow scientists below corroborating Dr. Chavez’s assessment of the Covid19 Sequence. Civilians will not understand this. I only understand 50% of it given my own study and work with the Amino Acids via the Mayan Time Science which Dr. Chavez is also familiar with. Nevertheless, this is important information that the government nor the media are going to tell the public. who they view as little children who need to be protected from the truth and controlled. Their control is working. Almost everyone is wearing a mask and it’s utterly ridiculous.

As you skim, please be sure to read the highlighted areas.-Lisa T.

My posting of today at the Research Gate: “By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical etiology of the SARS-CoV-2 Spike

https://www.minervanett.no/…/13/TheEvidenceNoNaturalEvol.pdf,

This is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers can do something about the restraint of the current deliberate madness of the satanic globalists that want full control of the individual using COVID-19 as their pre-planned “pretext”.

The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte

SARS-CoV-2 is possessed of dual action capability

Simultaneously it is capable of binding to ACE2 receptors

The likelihood of this being the result of natural processes is very small.”

The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation.”

A diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 spike acquired its special characteristics… the criteria of means, timing, agent and place…”

Why does this matter?”

“...a salutary review of failed vaccine programmes… (while our proposal is) not included in the Nature review…”

the eight methodologies reviewed in Nature are unlikely to prove immunogenic… especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)… we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved

“the SARS-CoV-2 Spike …is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade.”

“inserts placed on the surface of the Spike receptor binding domain… That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)”

“the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)”!!!, compared to human SARS-CoV-1 Spike “(pI = 5.67)”

“Basic domains – partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain – explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane”

“they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree… in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further”

“Andersen et al cite two authorities which actually say the reverse of what they say that they say… Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions… Wan et al contradicts Andersen et al’s opinion that it is improbable that the virus could have emerged through laboratory manipulation”

“Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors”

“make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function”

“a designed mutated strain (initially) lacking the furin cleavage site residues was used”

“there are 6 inserts which make the SARS-CoV-2 Spike structurally special”

“and there are five salient features that strengthen the case for purposive manipulation in the laboratory”:

1. A major part of the spike protein has human-like domains with matured transmission adaption… 78.4% of 6 amino acid windows are human like…a built-in stealth property… remarkably well-adapted virus for human co-existence”!!!

“Such high human similarity also implies a high risk for the (“vaccine”) development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)”

“surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution”

“2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed”

“Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged… even…to the negatively charged phospholipid heads on the cell membrane” With not even a need for a receptor!!!

“typically the objective of gain of function experiments… a strong indicator of manipulation”

“3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein… explained by an hypothesis of purposive manipulation”

“of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)… this …facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors… such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern… also reported by Zhou et al” (since “2018”)!!!

Other “receptors …most likely to be involved are CLEC4M/DC-SIGN (CD209)”

“charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed”

“4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor… Covid-19 …compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia”, etc.

“5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)… the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2… these capabilities were developed between 2008 – 2015… a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification”!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the “greater good” of spreading communism world-wide, the ultimate “goal” of the WHO, Gates, Fauci, NIAID, Eco”Hell”, etc…

“the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)… they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection”!!!

“…there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)… similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV… not… by “”natural” evolution””!!!!!!!

“we now add here a forensic analysis”!!!!

Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc…) they say: “…international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction… the evidence below attains a high level of confidence”:

“1. In 2008, Dr Shi …linked gain-of-function projects which lead to SARS-CoV-2’s exact functionalities… discovered via SADS …field-tested…”

“Ren et al (2008, including Shi) …successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “… a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding”

“2. In 2010 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans.”

Note:

So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planned situation, to look in retrospect, once this one is completely defeated at its roots!

But the fight continues as follows:

“They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)… Further new viruses were identified between 2012-2015 (Lin et al., 2017).”

And the next one is a “classic” of infamy:

“3. In 2015 scientists from the ‘Special Viruses’ section of the Wuhan Institute of Virology (WIV) were engaged in ‘gain of function’ experiments jointly with a majority team from the University of North Carolina Chapel Hill… a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 – a cell line contributed by Chapel Hill):”

“…and achieve in vitro titers equivalent to epidemic strains of SARS-CoV”, say there the cynical Baric and Zheng-Li.

“…it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi (“provided SHC014 spike sequences and plasmids”). We note that what is described here are, in fact, precisely SARS-CoV-2 properties.”

“Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15”

“the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract”

“a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue… (both with Baric and) …in the Wuhan Institute of Virology (WIV)”.

“4. In 2018, as discussed earlier, Dr Shi’s close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong… 25,000 piglets died… SADS is a CoV infection utilising new tissue-specific binding domains… Pigs …have immune systems very similar to humans.”

“in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat”: “Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors.” (Workman et al., 2015)”.

So, “the reconstructed historical etiology of the Spike (is) as follows:”

“1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread.”

Conclusion
“We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2…”

Additionally, in this wretched document;

 https://apps.who.int/…/annual_re…/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/…/annual…/GPMB_annualreport_2019.pdf ),

We have in plain sight the plan to take over humanity with the pretext of a “Pandemic”, the globalists are already in their non-conventional “Third World War” against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this “Plandemic” aligned, in the photos of page 42: 1) The “Gates Foundation”, 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the “Event 201″ in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late.”

Chasing a Vision of Your Better Self


Spectral Vision, Tone 11 is releasing, dissolving, and awakening

We all have things about ourselves we’d like to improve. That’s something that we have to do ourselves but sometimes it’s helpful to be inspired by someone else although that has never been the case for me. I know it devolves into ego competition so I just don’t do it. I hold myself to my own high standards; I don’t hold anyone else to them.

It starts out as positive admiration and respect between people, maybe even love. But humans, being mostly ego, it can quickly turn into competition. You think that a person is a mirror of you in some way and that you have affinity. It’s not because everyone is different and has applied themselves either more or less. It can quickly become coveting who that person is and what they have and then competing with them. You’ve corded them like a child to a parent or siblings on an energy level to take energy that you don’t think you have and can’t generate from within yourself (Blue Storm). They let you do it probably from tremendous pressure from our society to let ourselves be vampired on by our family members and friends. It’s the sacrifice narrative that runs very deep in the cabal because of the 12:60 timing frequency. It’s leads to addiction (lack, never enough) and co-dependency. You can’t be alone or don’t like to be alone. You have to suck energy off of others. Don’t do that.

They’re not supposed to let you do it to them. They’re supposed to let you know in some kind way to myob. We’re just sharing with one another. We’re not supposed to feed off of one another’s energy like a baby breastfeeding. It’s incredibly dysfunctional.

Sometimes being inspired by someone just means you want to compete with them. Competition is a bit of an illusion because there is plenty to go around and you can’t compare two people’s lives to each other and thus there is no competition. We’re all very different and have paid the piper different amounts based on our choices.

Ultimately, we’re competing with a vision of who we want to be and who we really are, so be careful projecting or offloading that onto others. Just look in the mirror and be honest with yourself if you really want power over your life.

Attributes of Blue 11 Eagle are; Releasing, Liberation, and dissolve, create, mind, and vision.

5GForce is Red 3 Serpent;

I activate in order to survive. Bonding instinct I seal the store of life fore with the electric tone of service. I am guided by the power of universal water. I am a polar kin. I establish the red galactic spectrum.-The Dreamspell

MOLECULAR LINE-UP

Channeling in Meditation is Quite Common


We are sitting in manifested receptiveness today which could be clairaudience which is psychic hearing, clairvoyance is psychic seeing or remote viewing, clairsentience is psychic feeling which is not the same as empathy, clairalience is psychic smelling, clarigustance is clear tasting. and claircognizance is clear knowing but that’s not the same as being prophetic or prescient. I experience clairaudience, clairvoyance, clairsentience and prescience. I also know how to turn it off though so I can focus on my own projects. Usually, when you turn the others on you start picking up all the static of our planet and it’s like having the T.V. on. No thanks. I am not entertained by being in a psychic airport which is why I don’t get high or drunk.

Using drugs opens up all of your chakras and you become a psychic garbage can. It’s not good for you. I get plenty of information from the ethers being fully conscious and focused in meditation. I’ve never been an advocate of drug use for that reason. In my opinion, if the males have such trouble receiving psychic information as women do, they might consider opening their HEART CHAKRA. It’s just as taboo for women to have their crown chakra fully open and enlighten their minds as it is for a man to have his heart chakra open and really love. It might not be normal on earth but it is throughout the Universe. We have some catching up to do.

Our programming from society and the media is going to pop in here and JUDGE what is happening. Do your best to set it aside and observe what you are picking up. The meaning of it may come later. ALL humans are naturally psychic. Our psychic senses are one of the things that have been psyop’d out of us by the elite so that we’re not empowered. Empowered humans don’t make good SLAVES. That’s where the psychiatrists and big pharma come in. It’s their job to keep us drugged so we don’t have multidimensional experiences in True Time and if we do we are supposed to believe we’re crazy. Yeah, that gig is UP! They are the Time Thieves and it’s over for them.

The Jaguar is a Mayan archetype of the Wizard or magician. She is a female priestess.

Tone 10 attributes are; producing, manifestation and perfecting. This kin are workaholics and finish a project to the end.

White Wizard attributes; enchantment, receptivity, and timelessness. This kin are very psychic, intelligent, aligned with divine will and J.C., magicians or musicians sensitive heart knowing, shaman and spiritual. The cat is an archetype. Men who love cats are a certain type of fella.

White 10 Wizard Themeplex
  1. White 10 Wizard Theme; Lysine
  2. Red 10 Serpent Analog; Serine
  3. White 10 Wind Guide Power; Glycine
  4. Yellow 10 Seed Antipode; Valine
  5. Blue 4 Hand Hidden Wisdom; Isoleucine

MOLECULAR LINE-UP

Valine and Isoleucine, Yellow Seed, and Blue Hand look almost exact. Well, the Blue Hand tribe came to this planet TO SEED a new way of evolution for the Human Tribe of Earth. My mother, sister, and aunt are Yellow Seed and Blue Hand raised by Red Serpent (my grandma) and they are AVID gardeners and appreciate nature TO THE MAX! They understand how to organize and beautify with all the carbon.

Set Your Intentions Daily or You’ll Be Programmed By Outside Forces and Media


From Abraham-Hicks. Notice these are all emotions that send you onto a certain path. They don’t have to control you.

I have to say, no matter what malarky is happening around me in human society I’m almost always at a 1 on the upward spiral. I don’t listen to or follow humans. Daily, I work with the universe and that’s how it’s always been for me. Maybe I’m a humanoid. I don’t know. We’re all just people evolving. The downward spiral is delusional lying to yourself. None of that is real. But I’ve learned people have reasons for sitting in shadow and I ABSOLUTELY accept it. Maybe it’s creative for them! There is no judgment and the universe watches over everyone.

The mental programming that’s going on right now is far more dangerous than CV2. I saw the most sinister, propaganda article by Google yesterday that stated that if everyone “cares” about one another by wearing a mask, CV2 will disappear. WOW! None of that is true and the experts will tell you that. Viruses never go away they just mutate!

The powers that be continue to play on natural human good intentions and good will to suck the life out of us for their nefarious purposes which would blow everyone’s mind if you knew the truth. Let’s just say we live in an inhabited universe and some humans have made alliances that are better for them than us.

Once a virus is born it never goes away. It just keeps mutating until it turns into DNA over a long period of time. By then it’s not very potent and doesn’t mutate on it’s own like the RNA retroviruses. And it’s ever so easy to get into a host since it’s microscopic. Nothing can stop it. They won’t tell you that. IF YOU BREATHE, and everyone has to breathe or you’d be dead, it’s already in you and just sitting there like every other virus on the planet eating the bacteria in your body that you no longer need. It’s no big deal as long as you’re chill and are happy.

That gets to the point of the today’s title. You’ve got to be inward and focus on controlling your own mind. We all came to this planet to check out the digs, to explore. Red 9 Skywalker is all about pulsing to explore and that is today’s theme.

The Skywalkers never give up and don’t lie. We have a code of ethics.
  1. The analog support is White 9 Worldbridger which realizes intention and pulses opportunity
  2. The Guide Power is Red 9 Moon which realizes purification and pulses flowing, universal water.
  3. The Antipode is Blue 9 Night which pulses dreams and intuition and realizes abundance
  4. The Hidden Wisdom is Yellow 5 Star which pulses beauty and art and realizes elegance.

With the New Moon in Cancer today and all of this new cosmic energy we can dream up a more beautiful, creative space for ourselves where we live. I was cleaning like crazy this morning and have new plans for my office to please my patients and myself. There is always room for improvement! The Moon is the mediating planet for the Guide Power, Red Moon.

MOLECULAR LINE-UP

Saturday Reading; Let’s Make some Blue 7 Monkey Mischief


This is a play day, which we all need. Whenever it’s Tone 7, whatever you think, do, or feel will boomerang like a voice in a cave. It echos so choose wisely. Tone 7 is actually also aligned with 12:60, the coordinate earth was forced into by Jupiter and Saturn. Since 7 was right in the middle of the Creative Tones it had the resonant effect for 12:60 that they were looking for in order to control things down here. That’s how 7 came to be considered LUCKY but 13 was UNLUCKY. There is no such thing as luck. But the fact is 13 is far more balanced and powerful for earth than 7 is. 13 also equalizes the power between female and male which is THE NORM throughout the galaxy. Earth is the odd one out there because of the time theft and we have much to correct. Our gender imbalance problem is toxic and anti-social.

Kin 111 is quite synchronized with the 11:11 phenom! The attributes for Blue Monkey are Play, illusion and magic. Blue monkey is artistic, spontaneous, trickster, innocent, humorous, extraordinary, divine clown, curious, co-creator of a higher life, transparent, and communicative.

7Asparagine

Resonant Tone 7 is about inspiration, attunement, and channeling.

The analog is Yellow 7 Star; beautification, art, and elegance

The Guide power is yourself; Blue 7 Night is dream, intuition and abundance

The antipode is Red 7 Dragon; nurture, being, and birth

The Hidden Wisdom is White 7 Dog; Love, Loyalty, and Heart

Kin #111
  1. Blue Monkey is Asparagine
  2. Yellow Star is Leucine
  3. Blue Night is Alanine
  4. Red Dragon is Cysteine
  5. White Dog is Aspartic Acid

MOLECULAR LINE-UP

It’s Saturday. Let’s Make some Blue 7 Monkey Mischief


This is a play day, which we all need. Whenever it’s Tone 7, whatever you think, do, or feel will boomerang like a voice in a cave. It echos so choose wisely. Tone 7 is actually also aligned with 12:60, the coordinate earth was forced into by Jupiter and Saturn. Since 7 was right in the middle of the Creative Tones it had the resonant effect for 12:60 that they were looking for in order to control things down here. That’s how 7 came to be considered LUCKY but 13 was UNLUCKY. There is no such thing as luck. But the fact is 13 is far more balanced and powerful for earth than 7 is. 13 also equalizes the power between female and male which is THE NORM throughout the galaxy. Earth is the odd one out there because of the time theft and we have much to correct. Our gender imbalance problem is toxic and anti-social.

Kin 111 is quite synchronized with the 11:11 phenom! The attributes for Blue Monkey are Play, illusion and magic. Blue monkey is artistic, spontaneous, trickster, innocent, humorous, extraordinary, divine clown, curious, co-creator of a higher life, transparent, and communicative.

Resonant Tone 7 is about inspiration, attunement, and channeling.

The analog is Yellow 7 Star; beautification, art, and elegance

The Guide power is yourself; Blue 7 Night is dream, intuition and abundance

The antipode is Red 7 Dragon; nurture, being, and birth

The Hidden Wisdom is White 7 Dog; Love, Loyalty, and Heart

Kin #111
  1. Blue Monkey is Asparagine
  2. Yellow Star is Leucine
  3. Blue Night is Alanine
  4. Red Dragon is Cysteine
  5. White Dog is Aspartic Acid

MOLECULAR LINE-UP

Balancing Equality on Earth Calls for Organized Thinking.


Are you able to track your own thoughts and feelings these days? It’s essential that you have organized thinking to make decisions that are safe and to have a healthy body as our society and media are turned upside down with lies and manipulations.  It’s never been much different than that but now it’s very blatant.

The world and the media around us are run by chaotic, addicted, psychopathic, greedy people who we have allowed to get into power. Why? Humans have a weak point that could easily be our downfall and that is believing what we WANT to believe about the outside world and others and not organizing our observations and thoughts to add it up to the truth. Mammals like to be comfy and domestic. We like to clean up our nest, mate, have babies, nurse them, feed them, work and cook. Most people want others to like them although the number is growing that don’t care. We can see that behavior all over the world in every culture and in the animal world. Anything that challenges that comfy mandate we have learned to take with us into DENIAL. That is especially the case if we had a physically or emotionally abusive childhood. The denial, we feel, helps us survive. I remember a client asking me, “Don’t you think it would be easier if I confront my parent about the abuse after we die and I see them on the other side?” This woman is a lovely spiritual person and this was her thinking. She wanted to remain in denial to not deal with something uncomfortable even though the truth would be revealed. If enough of the population does this societies turn into dictatorships with the population very easy to control because they’ve already been willing to be the emotionally walking dead. The answer is NO! don’t wait. Life is to be lived with faith and passion, failure and success. Grab the TRUTH With gusto and be your best self.

The reason we make this mistake is because we are co-creators with tremendous powers of soul, feeling, passion, and art. Meaning we instinctively know that whatever we personally put our minds and bodies to with regard to OUR OWN lives, it changes and manifests what we want. We’re taught that as children by saving our allowance and then buying something and learning how to ride a bike. We gain freedom of movement. People learn at different rates and with different levels of focus but from the time we are babies we learn that by executing certain behaviors we can get what we want. If we didn’t, we’d never get up on two feet and walk in order to go after it.

However, when it comes to OTHERS, that social piece is a big hang-up for humans. The smartest humans also learn from a young age to get what they want and how to manipulate others emotionally and mentally to get it. Those are the young politicians. They don’t mind lying at all and rationalize it big time. They learn to tell people what they want to hear and are rewarded when they get the response, “Now THAT’s what I wanted to hear.” They raise money and proceed into office rhetorically telling people what they want to hear, not the truth. They are opportunists on the backs of public indolence and then we blame them for being what we wanted them to be. THAT IS HAPPENING NOW on a much wider scale with health, our bodies, and politics. Everything in the media is lies.

Others are not the same as us, yet as young children we are essentially self-focused and see them as mirrors. They are not mirrors. It’s just the mirror neurons of the brain functioning to help us fit in and socialize our brain. What separates people socially are their VALUES which come from a conscience. Our families can only achieve so much in that area. The larger culture steps in affecting our own proclivities and we walk the line of loving others with healthy boundaries or using others with no boundaries.

That’s where SAFE behavior and observation and higher thinking comes in. Today it is seen as TONE 6 whose attributes are balancing equality with organization. There is little if any equal sharing of power on earth whether it be between genders or cultures (races is a misnomer). That’s because the levels of intelligence between humans has a HUGE DIVIDE. Most of the population can only organize their thoughts to the level of a fifth grader and the handful that are doing us in are evil geniuses. This is not a good combination and that is where we find ourselves today.

The Moon is in Gemini and Mercury is the mediating planet for White Dog∞Red Moon so as usual, that is an exact synchronicity with astrology.

Our theme today is White 6 Dog; Love, loyalty and heart. White dog is a strong leader, a guardian, a companion, consistent, faithful, a team player and a joiner. This is a nice change of pace and there are many people like this. It’s not necessarily safe for them to be on the street, but yes, they exist.

The Analog is Red 6 Moon; purification, flow and universal water. I blogged on Red Moon yesterday. Knowing how you feel helps you follow the road signs.

The Antipode is Yellow 6 Sun; enlighten, life, and Universal fire. This is a very spiritual archetype and White Dog is not terribly spiritual but more natural and simple. The Spiritual movement and habits can be challenging for them where in their Dog world, making a meal for someone they care for is as spiritual as they get.

The Hidden Wisdom is Blue 8 Monkey or Galactic play, illusion, and magic. This O.P. gives this kin great physical prowess to the point of being an athlete.  It is artistic with the body, spontaneous, extraordinary and a co-creator of higher physical life.

MOLECULAR LINE-UP

Methionine and the Stop Codon are the Start and Stop codon for the mRNA sequence. That is Yellow Sun and Blue Monkey