The Journey Board is a Circular Interplanetary Holon That is Our History


As you start at the top left on both of these images you see the energies from the outer galaxy come down to the earth through our Sun tribe 0 = 20. Galactic Pluto G-Alpha denotes that Pluto mediates this alpha point. Stay on the outer GREEN Ring on both graphics and the tribes will be in the correct order 0-19. Note that the difference between 52 and 33 is 19! The 0-19 code could very well be the code that unlocks the c%^&* hack on HF33 that occurred between kin 208, Yellow 13 Cosmic Star and kin 209, Red 1 Magnetic Moon.
Once you follow the outside left circle around to the Sun and it pivots over to the YELLOW inner ring, White Dog Tribe #10 mediated by Mercury. It’s Solar Mercury S-Alpha and turns around, just as it does on the first image.
The tribes in the Uranus transfer cell are tribe #2 White Wind and tribe 17 Red Earth (analogs), anf #3 Blue Night, and its analog #16 Yellow Warrior.
We are kin 138 today. On kin 208 in 60 days, we will repeat the Time Eruption, Time Theft that Intiates the Moon Genesis, The Central Green Castle of Enchantment. The date will be March 17, 2022, or, St. Patrick’s Day. Holy Smoke…The Church.
We’re taking it back, only it won’t be a green fairy or a green shamrock but the Green Castle that is finally the empowerment of our bodies that are not sin but life, light, and love. It will be time to clear the vines that have grown over our minds and bodies be ause of the erroneous Gregorian calendar and church teaching. Most people are over it. Then the church’s swcret documents need to be opened.
From the Dreamspell;
“In the magic flight from the two hundred and eighth step, yellow cosmic star to the two hundred ninth step, magnetic Moon, initiating the Moon Genesis, A theft occurred.
Imposters, male priests and warriors usurped the power of the thirteen moons. They hid the power of the thirteen among themselves and attempted to banish all memory of the matrix dreamspell of magic.
The Moon Genensis was to bestow the gift of the 13:260 ratio upon the planetary kin of timeship earth. The 13:260 ratio unlocks the vast powers of magical flight held by the central castle of enchantment. Instead, the planetary kin had imposed upon them the diminishing power ratio of 12:60. No longer the magic of thirteen moons but a twelve-month calendar of uncertain meaning. No longer the timeless gyre of magical flight, but a sixty-minute hour to earn one’s bread.
Time was compressed into a flat circle. (fake visual) the power of the twenty solar tribes of the planetary kin was reduced to the power of five instead of twenty. Slowly the kin gave their power away to the priests, while the priests of the calendar cast the dreamspell of history.
Despite the male priest corporate takeover of the third-dimensional Earth, the fourth-dimensional timeship continued to be woven. However, the fifty two steps of the central castle of enchantment came to be covered with an increasingly dense overlay, the dreamspell of history.”
History is of course the galactic karmic side of the interplanetary holon, the tribes from Yellow Sun to Red Moon 0-9. That’s why we have the preponderance on history and repeating it over and over to keep us trapped in this past time, time-warp. The Church aids and abbets in that and never moves into the future which is Spirituality, not religion. Their time is actually over now. The Real Intelligence of the Children of Earth who are awake will inherit the earth in wholeness. A.I. will be banished from our system.
Protected: Time Innovation: Synchronicity-A Mayan Oracle Apologist
Subscribe to continue reading
Become a paid subscriber to get access to the rest of this post and other exclusive content.
Watch “Dragon Bloodlines and the Serpent Seed – ROBERT SEPEHR” on YouTube
This highlights the origins of the Red Dragon tribe. Note at 41:30 the mention of Tiamat, the goddess of the chaotic Serpent.
Now recall that Tiamat/Maldek is the mediating planet for karmic Red Dragon/Serpent and dharmic analog White Wizard. Do watch this video. It gives insight into Tzolkonic archtypes.
Also note that the word dragon means “to see clearly”. On the body holon Red Dragon and White Mirror, its analog, rule the eyes. And of course we use our eyes to look into a mirror clearly once we’ve advanced in consciousness.
Listen for, “America is the land of the plumed serpent” according to the Inca.
Our Matrix vs. The Matrix Movies Clarified-Important

Jose Arguelles released the multi-density Dreamspell in 1990. He preceeded Hollywood in defining the process of natural, earth centered.DNA evolution before Cabal controlled Hollywood hacked the meaning of Matrix in a sci-fi movie series and suggested humans would be 4D programs grown in an A.I. machine universe without a soul who had an old white haired man as the source architect. This guy was a super mathematician and essentially heartless and reviled love. He said it to Neo’s face in Matrix Reloaded. After he gave Neo two evil, destructive choices, Neo said, “You better not be here when I get back” Hacker Jesus (what the 20-somethings call him) Neo said that to Hacker God sitting in his computer chair.
That whole scene was so offensive and ignorant regarding who God is. Check out the Urantia Book for better information. Better yet check our your own heart in meditation for the truth..
The first kin to use the word matrix in its mantra is Red Earth, tribe 17. It is the matrix of navigation. Then White Mirror, tribe 18 is the matrix of endlessness. Blue Storm, #19 is the matrix of self-generation, Yellow Sun, tribe 20 is the matrix of universal 🔥 fire. That’s it.
The rest of the action, starting with tribe #1, Red Dragon, is input, then store, process, and output. The matrix is only formed with the last 4 tribes and its a natural matrix OF EARTH, not machine. Note their amino acids; phenyalanine, tyrosine, tryptophan and stop codon. Proline is in there as a minor stop codon also whose 3 letter nucleotide oversees a few harmonics.
In the fictional Matrix movies they depict all DNA life as computer programs, 32-bit I suppose and that is in exact synchronicity with the I Ching oracle. There is that word oracle, also in sychronicity with the movies. And the role of the oracle was played by a loving black woman who was like a grandmother. That’s a direct hack of the loom of the 13 moons also, keeping to the female.
Zion is Israel, Nebuchadnezzar II, also spelled Nebuchadrezzar II, was their ship. He was the second king of the Neo-Babylonian Empire, ruling from the death of his father Nabopolassar in 605 BC to his own death in 562 BC. Historically known as Nebuchadnezzar the Great, he is typically regarded as the empire’s greatest king. Wikipedia. These folks were Mesopatamian TIME THIEVES. Just sayin’.
The Merovingian come up in the movie. Better look at this link and read up on it. https://en.m.wikipedia.org/wiki/Merovingian_dynasty.
The key maker was Chinese. That is a synchronicity with the I Ching oracle brought forward around 1000 B.C. The I Ching’s actual discovery and much of its early history are the stuff of legends. The keys are the hexagrams decoded as our amino acid nucleotides. That dude had ALL the keys but said he couldn’t do it anymore. Then he was killed by a Smith swarm, an analogy to modern day sex-trafficking cabal.
The I Ching
The I Ching has served for thousands of years as a philosophical taxonomy (every key to every gateway) of the universe, a guide to an ethical life, a manual for rulers, and an oracle of one’s personal future and the future of the state. It was an organizing principle or authoritative proof for literary and arts criticism, cartography, medicine, and many of the sciences, and it generated endless Confucian, Taoist, Buddhist, and, later, even Christian commentaries, and competing schools of thought within those traditions.
In China and in East Asia, it has been by far the most consulted of all books, in the belief that it can explain everything. In the West, it has been known for over three hundred years and, since the 1950s, is surely the most popularly recognized Chinese book. With its seeming infinitude of applications and interpretations, there has never been a book quite like it anywhere. It is the center of a vast whirlwind of writings and practices, but is itself a void, or perhaps a continually shifting cloud, for most of the crucial words of the I Ching have no fixed meaning.
The origin of the text is, as might be expected, obscure. In the mythological version, the culture hero Fu Xi, a dragon or a snake with a human face, studied the patterns of nature in the sky and on the earth: the markings on birds, rocks, and animals, the movement of clouds, the arrangement of the stars. He discovered that everything could be reduced to eight trigrams, each composed of three stacked solid or broken lines, reflecting the yin and yang, the duality that drives the universe. The trigrams themselves represented, respectively, heaven, a lake, fire, thunder, wind, water, a mountain, and earth. (NATURE) These 8 trigrams (3 letter amino acid nucleotides) multiply by 8 to make 64 nucleotides which make up the genetic code. They are seen as 64 harmonics with 4 gates each in the Tzolkin Harmonic Oracle.
The Tzolkin Harmonic takes it from there and multiplies 64 x 4 to bring the genetic code up to 256. The last 4 are in HF33 which has been hacked by the cabal for millenia by SMITH in a Hollywood, analyst, BLUE PILL kind of way. We await full activation of our 65 quantum DNA nucleotides so that we are in 13:20:260 code from the earth, not A.I Zion run by machines out of control.
Trinity is resurrected as White 13 Cosmic Dog which fully opens HF33, kin130. Binary 101, zeros and ones’s, the address of Hacker God in the control Room, isn’t going ro cut it in the new world. It’s in my book as a very short section. I remember putting it in thinking, “This is remedial. Why bother?”
Love from Galactic Center via the Sun is quantum code but it isn’t computers, robots or machines. It’s US, our bodies and minds aligned with the universe and the 13 Moons.
Time Innovation: Clarification of Evolutionary Action in 4D

I love this picture. I feel like this about humans and earth and so very sorry for the suffering and the mistakes the Universe and power hungry humans have made. God is perfect, but the universe workers are not. Everyone is evolving.
We live on a natural, evolutionary sphere that is a decimal experiment station guided by the Tzolkin Harmonic. The governing action is synchronicity, which you can only see if you realize we live in a free-will hologram, not a dense reality of chance, luck, coincidence, accident, or serendipity Those don’t exist in time. The only tribes that create the Matrix are the last 4 (see the bottom). The rest are doing natural evolutionary processes coming from the earth.
There are no machines helping us evolve well because they are programmed only with binary code.They are hindering our natural evolution with their erroneous programming. The only humans that are programs are those that allow their mindset TO BE PROGRAMMED by the MSM A.I.
Programming on television, written media, the internet, and movies is detrimental. Just turn it off. Our minds are totally programmable by us, and it is 100% within our power to focus our minds according to our choosing. This is what all of my work is about; taking control of your mind setup, thus your body setup and spirit setup. Body-Mind-Spirit is what the holon or holistic movement is all about, and we’ve been saying it for 55 years now. I’ve been saying and doing it for 26 years with my patients.
The purpose of the first 4 amino acid tribes; Red Dragon Cysteine, White Wind Glycine, Yellow Seed Valine, and Blue Night Alanine, is to input energy into the body.
The purpose of protein tribes 5-8; Red Serpent Serine, White World-Bridger Threonine, Blue Hand Isoleucine, and Yellow Star Leucine is to process energy in the body.
The purpose of protein tribes 9-12; Red Moon Methionine, White Dog Aspartic Acid, Blue Monkey Asparagine, and Yellow Human Glutamic Acid is to store energy in the body.
The purpose of protein tribes 13-16; Red Skywalker Glutamine, White Wizard Lysine, Blue Eagle Arginine, and Yellow Warrior Histidine is to output energy in the body.
The purpose of protein tribes 17-20; Red Earth Phenylalanine, White Mirror Tyrosine, Blue Storm Tryptophan, and Yellow Sun Stop Codon/ Proline is to create the matrix.
(My son born in 1999 is in this last group. He and his friends are very much aware of their mission. They are GenZ)
How Can Anyone Accurately Predict the Future If they Only Look at Past Patterns?
The future only exists to the extent that we create it. Otherwise, the past keeps repeating itself. We are co-creators and need to feed the future with our intentions and our minds daily. What do we want our future and humanity’s future to look like? Hardly anyone does it because they’re distracted with all the outside activities in the 4D Matrix and with the past. It’s set up that way on purpose to vampire your mental energy. That’s how our minds get locked down and controlled. That’s why time warps on a planet. It’s like a wood bench in the backyard warping from moisture.
The brand new Matrix movie, “Resurrection” is the best one yet. I just watched it. Please note that Trinity resides in HF33 kin 130 and White 13 Cosmic Dog. Neo is kin131, Blue 1 Magnetic Monkey. This movie looked like the HF33 gate spinning the whole time. Is “the analyst” a perfect poster child for the cabal or what? King of the Blue Pills.
The Tzolkin Matrix comes from Implicate order into Explicate Order but doesn’t lose its multiverse aspects, just like the movie. The Tao te Ching says “keep to the female” and Trinity holding him up and helping him live is an omen of the female finally leading and finding equal status with the male as we proceed here.
Watch for all the synchronicity yourself. But the Matrix movies are a hack of HF31 and the Mayan Oracle. They steal all of the ancient symbols and put a new meaning on them that points to a machine world. No deal.
Astronomers Have Evidence That Our Solar System is a Magnetic Tunnel
Corey Goode told us this 6 years ago from observing off-planet portal systems and the cosmic web.
Our DNA is Time But Its Source is Timelessness

Timelessness is one with our DNA.
What animates our human flesh of DNA is timelessness. As you ponder this instead of taking for granted your warm body, breath, mind, thinking, and physical movement, know that what makes you a conscious warm body is eternal. The energy that enlivens you never ends. It is eternal or beyond time. It is one with your FLESH, manifested DNA.
DNA is time but it is also timeless because it’s Source is timelessness.
Even though it’s manifested in time that doesn’t limit its power. You can align anything out of balance. You have the power in your flesh and blood to HEAL YOURSELF. You don’t really need any meds, tech, etc. Just focus your mind INTO your body with intention. It’s like being thirsty and swallowing cold water. Perfect.
An Insight As I Talked to My Mom This Morning
I spent an hour talking to my mom this morning. She is 81 but she doesn’t look it or act it. She is still enjoying life and talks about living to be 100. Unfortunately, the people in her generation, born in 1940, were taught to value the past more than the future. Most people walking around today, except for the kids, are taught to FEAR the future, especially now with all the fear-mongering. That’s an ENTIRE STRAND OF OUR DNA that people are ignoring and are usually afraid of the AC strand; aboriginal continuity.
We chatted about time and I said that, as of today, I have another new perception of aging, or stress that deteriorates our DNA. What ages people is their preponderance on the past instead of learning from it and letting it go. Balance and synchronicity manifest in the body when our MINDS focus on the future half of our time and the past the other half.
Time starts to spiral to the point where we reside IN OUR SPINES mentally which is the AXIS OF THE ETERNAL PRESENT. That’s where meditation on the spine is beneficial. We can remote view and see moving pictures of our past and present when we are still and breathe into and out of our spines. Just breathe naturally the galactic in-breath and the solar outbreath which I’ve taught you on here a myriad of times as the Interplanetary Holon.

The in-breath is the past and the outbreath is the future (because you’re breathing out the past). The first 10 tribes or amino acids are the past and the next 10 are the future. The in-breath is “male principle” and the outbreath is “female principle”. Men absorb the female energy and their life forces come out and into us and we breathe OUT of our bodies’ new life, a child. Men breathe it IN, women breathe it out. This is very fundamental stuff to mediate on in the body. We are different yet we are both female and male and breathe in and out.
What we call “aging” is “timing” or staying on a certain timeline that restricts our possibilities. We focus our time ON THE PAST and deteriorate because we don’t bring into our consciousness more diversity, curiosity about the present and future time, the young people, what’s changing on the planet, and new experiences. When our minds go that way our bodies will also!!! It’s good to keep your body coursing with future DNA. We are co-creators with the universe not just onlookers of the past. Easy for me to say as Red Skywalker on the future side of the holon and attributed with Prophecy. But we all have all 20 amino acid tribes in us.
I think this is key to the light body that will be coming.
New Discovery. Table 2 in Time is DNA Has Been Updated; The Themeplex translated to RNA/DNA codons Master Document.
Subscribe to continue reading
Subscribe to get access to the rest of this post and other subscriber-only content.
Synchronicity; Cause and Effect in Your Birth Harmonic and Inverse Harmonic; Past and Future as Two Strands of DNA as Time
What Goes Around Comes Around in Time is the DNA Double Helix as TIME. It’s in our bodies
In your own DNA, your birth gateway contains your Occult Power at the bottom. Whichever 4-day harmonic your occult power sits in is your inverse harmonic. All 4 kin of that inverse are to be studied to understand your soul lessons. It’s why you’re on earth.
The 4-day harmonic that you were born into, illuminates your DHARMA, has detailed wisdom for how to move forward into your future, and creates the details of your destiny. This is your AC timeline or future into the present. We call it Aboriginal Continuity or the Dreamtime.
Your inverse harmonic which contains your Occult Partner or Hidden Wisdom in your Birth Gateway has detailed wisdom for you to act on moving past your karma, issues with your Mother, and current programming to change your past so that it no longer influences your mind and emotions unduly. You will see issues with your birth mother or person who was in the role of mother for you from birth, on this kin.
Be sure to ponder and study all four kin in your birth harmonic. For issues with your father you can just spin up his birthday in the birth calculator in the app and see what his birth gateway is. The app Grok and I are creating should tell you any synchronicities. If they aren’t specifically with you, they may pulse off a sibling in your household that affected you or your mother.
The latter is the most difficult for people because our current misaligned society teaches that family is like God, sacred and holy no matter how they treat you or how remedial their own soul development. My book Healer addresses this issue and my own story about moving past it. I have found the kin and details of each kin in my inverse harmonic to be negative and highly charged with my own karma that needs to be released so I can have a happy, healthy life and not necessarily have to come back to this planet. It is highly important that we all face our karma and know in our souls what must be done to align it. Then you need to take action.
Also, the occult partners on each of your kin in your birth harmonic are the four kin in your inverse harmonic. That is the power of your own hidden wisdom or your mother’s DNA pulsing on your karma to lead you forward to choosing your future.
Many times there is a tremendous struggle, resistance, and hard lessons to be found in the inverse harmonic and it starts in the home of your birth with your birth family. If you parse out these gateways you’ll see the details of it, recall your past, and realize that it was all SYNCHRONICITY for your learning. Do not curse it but BLESS and RELEASE.
It is difficult not to resent serious wrong-doing from people who said they loved you but that is par for the course on earth. Each of us has karma in different amounts so there are no casting stones. Someone else’s karma is not your business. Your karma is your business. If you try to control others’ karma or judge it you will be making more karma for yourself. It’s important to know that the Universe takes copious notes, all is seen and recorded and will be adjudicated in true justice after death.
The hope is that by the age of 52 you are mentally and emotionally dwelling on your dharmic BIRTH HARMONIC and the detailed lessons offered there on each of the four kin. It also crosses with your Sabian symbols which I’ve posted. The link is jamesburgess.com, click on Sabian symbols and then calculator to first see your own and how it merges with your Tzolkin density patterns. It’s basically another perspective on the Interplanetary Holon or Astrology. Mine is spot on. It doesn’t hurt to continue looking at your entire 13-day cycle that your birth themeplex resides in because as I perused mine, every kin had key people that have affected my destiny and synchronicity.
KRSFIEDLLFNKV-The Covid19 Virus general sequence used to make a vaccine…maybe.
The letters in the title are the single letters that represent the dominant amino acids in the SARS- CV2 virus.We know from Dr. Chavez that the CV2 signature is artificial but the NIH scientists are looking at the natural zoonotic one. I don’t think they are the same. NIH may be lying.
This might be false information again to throw everyone off the track. Remember, they’ve been working on the artificial signature since 2009 and the real questions will be, once the artificial signature is analyzed in light of the Tzolkin how will the vaccine mRNA sequence they have manufactured interact with it?
Since it’s mRNA it can keep mutating. They address that in the link above but not to my satisfaction. This is messenger RNA which is part of the initiation of the RNA sequence.
Q: What determines the mRNA codon?
A: The cellular discussion between the ribosome and the amino acid through the tRNA or transfer RNA which is the Tzolkin Themeplex. They have no clue. My book isn’t out yet.
The tRNA looks like the Tzolkin themeplex and I go into it extensively in my book.
This is 4Leucine∞4Asparigine, 4Valine, 4Tyrosine, 10Glutamine as a tRNA molecule in my opinion. The 3 dimensional image above of the double helix corresponds exactly to the binary triplet configuration I have figured out and have made a huge complex document I’m currently getting into my book that will explain how the G.A.P. kin of the Tzolkin form the ladders that likely are the ribosomes and the double helix may be the sugar backbone. I’m not sure yet. But it all pulses exactly off of the mother’s DNA in the double helix as the Hidden Wisdom or subconscious mind everyday.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151553/
It boils down to this. Note that there are 13 Amino Acids in the Sequence the NIH gives us. If only the scientists understood the application of the 13 Tones of Creation it would revolutionize genetics.
I’m breaking down the sequence from the TITLE above
- White Wizard is K or Lysine – 1st appearance
- Blue Eagle is R or Arginine
- Red Serpent is S or Serine
- Red Earth is F or Phenylalanine
- Blue Hand is I or Isoleucine These two
- Yellow Human is E or Glutamic Acid are analog
- White Dog is D or Aspartic Acid
- Yellow Star is L or Leucine
- Yellow Star is L or Leucine
- Red Earth is F or Phenylalanine
- Blue Monkey is N or Asparagine
- White Wizard is L or Lysine—Last appearance
- Yellow Seed is V or Valine
It turns out this sequence is found in all zoonotic origin coronaviruses and it is very bare bones, no start or stop codons nor the rest of the 20 amino acids.
Zoonotic means we evolved from animals and ARE animals. This is no big news. The big news that they are not specking out is the artificial sequence which I already have. What is the agenda behind the creation of the artificial signature?
Note that the sequence begins with the White Wizard and Ends at #12 with the White Wizard and then is SEEDED into the ground via Valine or the Yellow Seed Tribe.
I may add more to this or I may not. The link above is very long and involved but I’m not sure I trust it.
Lisa T.
Fresh Sequences out of the Lab from Dr. Chavez. They are Sleuthing out the Source of this Artificial BioWeapon
This post is from August 2020.


For instance, In harmonic 1, the very top left is Red 1 Dragon. Red 1 Dragon is 1 Cysteine in the nucleus of the tRNA molecule, 1 Tyrosine in on the right analog, 1 Cysteine is above as the Guide Power, 1 Asparigine is the anticodon and the Tzolkin Antipode and 13 Stop Codon is the Hidden Wisdom. If you go to HF 65, the INVERSE HARMONIC of HF1 you will find the binary triplet configuration pulsing EXACTLY off of that molecular line-up in HF1 on every single kin, on theme, hidden wisdom, and analog.
Here are the sequences of Covid19
As of TODAY from the lab, Imagine every 3 letters to represent 1 Tzolkin Harmonic which as we know, has 4 kin composed of 5 archetypes in it. I’ve got the DNA worked out according to the Tzolkin Code but I don’t have it in a database so I’m doing it by sight. The hope is that the inverse harmonics, which I’ve found balance the tRNA in each kin, will help them find a medicine that can at least shore up our strong, natural immunity. This thing is an artificial bio-weapon so a natural cure will only work part of the way. Honestly, the reason this thing HAS NOT turned into a full-blown pandemic is because of the social distancing. The masks are useless. Why did they release a bioweapon? These protein signatures can provide clues.
I’ll be honest, Dr. Chavez has me alarmed as I read his response to all of this. If you look at the numbers on a planet of 8 billion people, by no means is this a pandemic at this point, thus the protest. But they are concerned it could become one so maybe that’s why they’re calling it that.
Also, HCQ should be on hand everywhere as well as the anti-viral Chinese herbs. I have them in my office and took them when I had it. They work!!
The main analyzed regions
Region « A », Location of the 600 bases from the COVID_19 reference genome “Wuhan market” ID: LR757998.1.Its length was between 21072 and 21672 nucleotides.
AGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCC
See details alignment in supplementary materials « a ».Region «B», Location of the 330 first bases from the COVID_19 reference genome “Wuhan market”ID: LR757998.1.Their length was between 21672 and 22002 nucleotides (then immediately following region «A»:COVID-19, SARS and Bats Coronaviruses Genomes Peculiar Homologous RNA SequencesInternational Journal of Research -GRANTHAALAYAH 220
TCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGT
See details alignment in supplementary materials « b ».We analyzed this larger region which starts at the same address as our region “B”: entitled « Region Lyons-Weiler » [4]. Their length was between 21672 and 23050 (1378 nucleotides) within the reference genome Wuhan market: LR757998.1In the RESULTS and DISCUSSION, we will more particularly analyze a small region of 225 nucleotides of the reference genome:
TGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAA
A Refresher on the Tzolkin Clans
Which Clan are you in? As Red Skywalker I am in the Truth Clan which is obvious by the way I write on here. Also notice your Chromatic on the top line. These colors form the aurora borealis which is the light emanation of the Tzolkin. Starting from the left, the Yellow chromatic is led by Yellow Sun whose job is enlightenment and Christ consciousness. All the tribes below follow their lead.
Red Chromatic is heavily about DNA evolution, blood memory, survival and Maldekian karma. The Red Serpent Reptilian people are a force to be reckoned with, strong leaders and not all bad. Only some went rogue. Their mediating planet is an asteroid belt so…nothing is easy here. The tribes below follow their lead. White World Bridger more than the other ones below have struggles with Maldekian karma from the blow up.
White Chromatic is led by Mercury, White Dog, love and loyalty. Our standards of conduct are ridiculous. There is no way everyone can please us so we should not expect it. We are a different sort with a mission on the planet, usually introverts but end up in the public eye leading. We seem like freaks, very gifted, all 5 of those tribes, but we love our work. Don’t expect us to mince words. We already compromise constantly on this energy compressed planet.
The Blue chromatic people are indomitable and intelligent with magnificent vision. Blue Eagle from Jupiter leads and sets the tone for the Vision. These are the outer planet tribes; Jupiter, Saturn, Uranus, Neptune and Pluto. They are in a shake-up right now with the cosmic cycle changes. Their atmospheres and storms are reversing. I don’t really want to think about what that might mean. The sky seems to be falling in the sky clan.
The clan TIME PORTALS are positioned on the planet at specific latitudes of 60°N, 30°N, 0°Equator, 30°S, and 60°S. Then earth is split into 8 plates over which the 64 I Ching Hexagrams are distributed 8 to a plate.
This also applies to positions on the body that relate to the chakras
The number on the hexagrams add up to 260 vertically and diagonally to pulse EXACTLY with the Tzolkin 260-day cycle. In this way, the solar cycle of 365 days and the Tzolkin cycle of 260 days sprocket exactly to keep the hologram in the Matrix aligned, thus our double strand DNA moving past-present at the same time in every cell of our bodies and IN THE EARTH. This is the synchronized movement of our own BODY HOLON and the EARTH HOLON. The issue right now though is, the earth is changing so quickly I can barely keep up. I can monitor the body and the interplanetary one though.
Polar is Crown of the head, Cardinal is throat chakra, Core is Heart chakra, Signal is Solar Plexus chakra, Gateway is Root chakra
The Fire Clan (Empath, Intuitive, and Psychic Info. Focused)
- Yellow Sun-Polar
- Red Dragon-Cardinal
- White Wind-Core
- Blue Night-Signal
- Yellow Seed-Gateway
The Blood Clan (Family and Ancestry Focused)
- Red Serpent-Polar
- White World-Bridger-Cardinal
- Blue Hand-Core
- Yellow Star-Signal
- Red Moon-Gateway
The Truth Clan (Telling the Truth and Free Will Focused) We’re the least popular.
- White Dog-Polar
- Blue Monkey-Cardinal
- Yellow Human-Core
- Red Skywalker-Signal
- White Wizard-Gateway
The Sky Clan-(Intelligent, Vision, and Rebellion Focused)
- Blue Eagle-Polar
- Yellow Warrior-Cardinal
- Red Earth-Core
- White Mirror-Signal
- Blue Storm-Gateway
Is the 13-day Cycle an mRNA Sequence?

I hypothesize that each theme-plex is a tRNA molecule. To the right is our current 13-day cycle. 1Lysine, 2arginine, 3histine, 4phenylalanine, 5tyrosine, 6tryptophan (today) and the start codon methionine is in the theme-plex today as the antipode to move us to Red Dragon after the sequence ends at 7Stop Codon tomorrow. It’s also the Full Moon so that is a great synchronicity. All cycles stop.
What is 13 x 5? 65. That’s the number of amino acids in a 13-day cycle. Remember, all you’re seeing on the right are the themes. Multiply them by 5 and the whole thing is in exact alignment with the way the genetic sequence moves.
8Cysteine, 9Glycine, 10Alanine, 11Valine, 12Serine and 13Threonine. But that’s just the macro picture. The micro-picture is the entire theme-plex of each kin which is the tRNA molecule composed of five kin or the five-membered, nitrogen-containing ring. That pulses off of the molecular sidechain that needs PROLINE to move. It pulses tryptophan, proline, stop codon and the geneticists see this progression and call tryptophan and proline a type of stop codon. They are basically the amino acids putting the bakes on the forward movement of the sequence; 19, 20, 0.
mRNA is messenger RNA and is coded by the DNA nucleotide which are symbolized by the I Ching hexagrams. Those 6 lines are decoded down to the 3 big letters; T, U, G, A, C which overarch each Harmonic Family and control the mRNA. The tRNA, our 5 archetype theme-plex acts as an adaptor between the DNA and the mRNA. The tRNA codes the mRNA from the ribosome. This is all basic reductionist stuff that does not make my blog popular but is essential to help make the correspondence from the Tzolkin to their linguistic set of terms in molecular biology.
Methionine is always the analog of Aspartic Acid meaning Red Moon is always next to White Dog. It’s always the Hidden Wisdom or Occult Partner of Glutamic Acid or Yellow Human. It’s always the antipode of Blue Storm and Blue storm is the antipode of it. Tryptophan, Blue Storm is always right next to Red Moon. And that’s exactly how the amino acids move; Methionine starts the sequence, it proceeds through some amino acids, lands in a tRNA molecule next to tryptophan, is stimulated by ever present Proline in the strands and hits a stop codon, (Yellow Sun)
This is a section from my book in case you’re interested in the role of nitrogen;

Stop Codon = Proline; 0 = 20
0=20 is vigesimal mathematics which is Mayan math. This type of math can compute epic exponential cycles like universal cycles…and oracles.
Nitrogen, it turns out, is an epic natural, ancient chemical that interacts directly with our 20 glycogenic proteins that are symbolized by our 20 Mayan archetypes. Proline is the only proteinogenic secondary amino acid (secondary stop codon) which is a secondary amine as the nitrogen atom and is attached both to the α-carbon and to a chain of three carbons that together form a five-membered ring. In organic chemistry, amines are compounds and functional groups that contain a basic nitrogen atom with a lone pair.
Nitrogen-fixation happens during a thunderstorm when lightning fixes nitrogen in the soil and plants. That’s why everything greens up quickly as long as the roots are open for uptake. Lightning is also an archetype for Blue Storm or tryptophan which is a light weight stop codon in a DNA sequence.
They all have the sun in common. Blue Storm is Yellow Sun’s analog and a sub-stop codon as tryptophan. Proline is a non-essential amino acid for our bodies but essential in moving nitrogen into the side chain. It functions as ZERO in Mayan math which is huge. 0=20 which means Proline = Stop Codon. Together they function as archetype Yellow Sun which pulses directly to our great star, The Sun, all the time. The evolution of density frequencies on earth pulse directly to the sun which then sends information to Galactic Center.
Proline being proteinogenic is a big synchronicity with the 5 member Tzolkin theme-plex. Proline is unique in that it is the only amino acid where the side chain is connected to the protein spine twice, forming a five-membered nitrogen-containing ring. For this reason, Proline can often be found in very tight turns in protein structures (for example, where the polypeptide chain must change direction). This is reverse polarity which is a function of the Tzolkin. The polypeptide chain changes direction…in synchronicity with TIME changing direction between the strands via the G.A.P. kin.
Where is the spine of a double helix? They are the two spiraling strands. The chemical spine of the double helix is made up of sugar and phosphate molecules that are connected by chemical bonds, known as a sugar-phosphate spine. The two helical strands are connected through interactions between pairs of nucleotides, also called base pairs which are the ladders in between strands.
The protein spine is what holds a protein together and gives it an overall shape (or tertiary structure). … Each segment of a protein is the residue of an amino acid. Strong peptide bonds join the segments, forming the spine. Except for the ends of a protein chain, the spine of each segment contains the same atoms. Proline functions in the side chain.
I’ve substituted the word spine for the usual word backbonebecause thespine is crucial in the Tzolkin Harmonic; literally in the Body Holon and figuratively as the Mystic Column down the center of the harmonic. It is a reversal zone or the Zone of Transformation between the harmonics just as our own spine is a reversal zone of nerves to both sides of the body.
Natures’ Starships; Meteorites
In space and time, these amino acids in these groups pulsed off of one another to move up to the next group…according to the oracle. This could be very helpful to scientists. It should also be helpful to know that proline is inextricably in relationship with our sun as well. Proline is one with the stop Codon and pulses directly to it. According the to the Tzolkin, the Sun is archetype Yellow Sun. It has a key role in exponential timelessness universally.
The Solar Seals on page 89 are one with the Amino Acid Proteins. Notice at the top left it says 0=20 for Yellow Sun.
This is according to Tzolkin Harmonic Archetype number;
1, 5, 9, 13, 17 (cysteine, serine, methionine, glutamine, phenylalanine) All RED initiators.
2, 6, 10, 14, 18 (glycine, threonine, aspartic acid, lysine, tyrosine) All WHITE refiners.
3, 7, 11, 15, 19 (alanine, isoleucine, asparagine, arginine, tryptophan). All BLUE transformers.
0 = 20, 4, 8, 12, 16 (proline-stop codon, valine, leucine, glutamic acid, histidine). All are yellow ripeners.
Friday Daily Oracle; We Activate Our Intuition As a Dream We BOND to Seal our Abundance and Actually be of Service
I Activate in order to Dream. Bonding Intuition, I seal the input of Abundance with the electric tone of service. I am guided by the power of accomplishment
1:3:3:3
Dreams are literal on the unconscious mind level. They are real in another density, not dimension. Layers of energy frequency are density. Humans have felt them forever. That’s what the phrase “The tension was so thick you could cut it with a knife.” means. People have said that forever and they use their intuition to read the room. That’s real and it’s usually accurate.
Dimension is H x W x L x D; height, width, length and depth or 3 and 4D and people hold onto it with their fists as though that’s all there is.
Science has proven anywhere from 7 to 21 dimensions although they may mean density. We’re in flux here so you may want to open up your perceptions of reality. It’s potent in geometry and physics for quantification and measuring, all Tone 4 activities and they are the 4 dimensions. I would say depth is time. And think about depth. There is no end to it, like digging a hole to China or going through the center of the earth and out the other side. Space leads to time which is actually timelessness. We can all feel that.
Body Holon
- Theme is 3Alanine or Blue 3 Electric Night; Abundance
- Analog is 3Histidine or Yellow 3 Electric Warrior; Intelligence
- Guide Power is 3Isoleucine or Blue 3 Hand; Accomplishment
- Antipode is 3Glutamine or Red 3 Skywalker; Prophecy (That’s right) LOL
- Hidden Wisdom is 11Tyrosine or White 11 Spectral Mirror
- 5GForce is 11Phenylalanine or Red 11 Spectral Earth. Today is Alanine and we have Phenyl…in there in 5th density. In organic chemistry, the phenyl group, or phenyl ring, is a cyclic group of atoms with the formula C₆H₅. Phenyl groups are closely related to benzene and can be viewed as a benzene ring, minus a hydrogen, which may be replaced by some other element or compound to serve as a functional group. Wikipedia.
- THE AMINO ACIDS ARE ABSOLUTELY IN SYNCHRONICITY WITH THE PLANETS THAT MEDIATE THEM. You’re welcome.

Let’s talk about the Mirror for a second. It keeps coming up when I watch a show on Prime Video or talking to someone. It is said that the mirrors in our world that we use, made of quartz crystal and silver, reverse the image in the glass so we are seeing ourselves in reverse.
Look in a mirror. The left side of your face IS ON THE LEFT in a mirror and the right side of your face is ON THE RIGHT in a mirror. That is an exact reflection of yourself to yourself. It’s not reversed.
It IS reversed compared to how OTHERS see us. They see us backward. When you look at someone, you see the right side of their face as their left side. You see the left side of their face as the right side. What’s reversed is OUR vision of others, not the mirror.
Do I somehow have this wrong? I don’t understand why they say the mirror reverses our image? We reverse each other’s image and it’s true that we do not see what others see when they look at us from all angles in real life. All we have to do to see ourselves from all angles is hold up a mirror to another mirror and turn around 360°. I do that often myself. It’s very enlightening.
Interplanetary Holon
Saturn is our mediating planet today. Saturn has a had a significant hand in setting our DNA patterns on earth, obviously. You can see the hexagon everywhere. I’m grateful. After our epic screw-up on Tiamat we obviously needed some help and discipline. Let’s hope we get our act together now so we can run our planet without so much E.T. help. We’ll see. Humans need to be more logical and reasonable and get their emotions under control, imo.
Time Innovation: Astronomy-David Wilcock on GAIA Regarding Saturn
There are so many synchronicities with my Tzolkin research in this! And Dr. Luc Montagnier, Nobel winner molecular biologist is brought up. He worked with my friend, Dr. Chavez.
https://www.gaia.com/share/ckszbub8h000x0jpndz6f6iwl?rfd=RQvcgo&language[]=en

Saturn rules Capricorn and mediates Yellow Warrior-Histidine ~ Blue Night Alanine.
Dec. 5, 2010, the date they saw the huge “serpentine storm” on Saturn was Red 7 Resonant Dragon. Major synchronicity.
They all keep wondering where the changes are coming from. All Sentient DNA in our local system! My opinion; Physicist David Bohm’s bridge between implicate and explicate order connects galactic center to the interplanetary holon, all 10 planets. They all have Psi Banks and they all function according to the binary triplet configuration where the Zone of Transformation is in the middle, then there is a N. Polar Zone and S. Polar Zone.
The planets own Psi Bank regulates how Time moves on each planet according to the role it plays in the Tzolkin Harmonic. And of course they all regulate two archetypes or amino acids for evolution of life in our particular solar system. 13:20.
Saturn played a key role in keeping our species together after the Tiamat blowup. The changes are occurring bc it’s role for us is changing with our ascension. We no longer need its control.
David is Yellow 10 Planetary Seed.
The Reverse, Backward Movement of the Harmonic in the Psi Bank

What you see above are 8 Tzolkin Harmonics, 4 facing up, 4 facing down but diagonal from each other. Look at the ones on the bottom. Red 1 Dragon, kin#1 is in the bottom right. If you turned it right side up it would look just like the top harmonics. This shows how they are processed through the Psi bank like computer code. This is from Earth Ascending page 149.
It’s a type of mirroring in synchronicity with today’s theme-plex; White 11 Spectral mirror. I started on this idea yesterday wondering about what was really happening with mRNA reverse transcriptase that Bruce Lipton was talking about in his video that I posted a few days ago. Listen to it again. He says that the DNA Dogma taught that the DNA only moved in one direction. That’s not the case once you understand mRNA reverse transcriptase and that speaks DIRECTLY to Tzolkonic Movement and current epigenetic claims of being able to program your own DNA by going backward. Or, as I’m suggesting in my book based on research, past to present or future to present AS TIME. Nobody knows that yet but us. Earth Ascending was written before anyone understood epigenetics; 1984.
You can see the backward movement in this image. The bottom four harmonics are upside down. That’s a #20 along the left side and #13 across the top; 20 tribes of time or 20 A.A. and 13 Tones of Creation.
I’m studying this in alignment with three locations on the ribosome of the double helix that is added to the A.A. sequence; A site, P site, and E site. Once the RNA picks a site it’s copied into the helicase BACKWARD as fast as a jet plane. It’s shown in a couple videos I have and I’ve posted it on here before. The scientists have seen the actual movement but they don’t know what causes it…of course.
Then it goes to the mysterious Kinetochore where eventually it’s turned into a chromosome and then a nuclear pore with a nuclear membrane that breaks apart. I’ve watched the process several times.
Back to the ribosome; it comes from the mRNA (messenger RNA which is being utilized by the CV2 vaccine makers to program our RNA with god knows what). The mRNA moves like a computer program through the ribosome, through a few more steps, until it’s turned into tRNA or transfer RNA.
What are the three types of mRNA?
- mRNA (messenger RNA): Produced during transcription.
- rRNA (ribosomal RNA): Together with proteins, composes the ribosome, the organelles that are the site of protein synthesis.
- tRNA (transfer RNA): Brings the correct amino acid to the ribosome during translation.
Once again, it seems to me the Tzolkin Harmonic Theme-plex is the tRNA that brings the correct amino acid to the ribosome during translation. Of course all of this is in dynamic evolution though and is never exactly the same so that’s where the patterns I’ve observed come in such as the occult partner (your mother’s DNA) and the alpha and omega point placement. It’s not simple. In addition, the function of the G.A. P. kin are epic. That’s in the book as well.
I hate to tell the scientists this but none of it can be controlled. 98% of evolution is beyond any human or stellar species control. People experiment with it but I for one am not convinced that’s terribly wise. It depends on what they’re doing. Natural evolution is not the same, by far, as genetic experimentation on different species.
My point is, the reverse transcriptase happens through the mRNA whose action is in synchronicity with the movement of the harmonic in the Psi Bank or ELM Van Allen Belts around the earth.
Time is an Abstract Concept Currently
But time is not abstract, it’s concrete within this dimension because of the holographic matrix powered by Our Sun. The Sun isn’t abstract. You can see it and feel it. Scientists have gotten close to it with the Van Allen probes (the Psi Bank) and analyze it’s activity constantly but I don’t know if they actually feel it or get what the Sun is about. Galactic Center, Pure Love and Light come through the Sun as a type of movie projector and sustains all life, good and bad for our soul education. The Psi Bank is the Source of the Tzolkin Harmonic which programs DNA. That programming of DNA creates gravity and time.
The only way something can be apparent is if light is shining on it. Our light comes from our Sun which astronomical science has proven to move in distinct, predictable cycles that directly affect us and all life on earth because of ELM, or electromagnetism. Think of it as a combination of magnetic tone one and electric tone 3 brought together by polar tone 2 which is the binary crossover polarity of + protons and – electrons. That all happens in DNA and once again, it’s established that all life has electromagnetism within it.















You must be logged in to post a comment.